Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant polygene genetic transformation method

A genetic transformation, multi-gene technology, applied in the direction of plant gene improvement, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems affecting the stability of genetic transformation efficiency, uneven quality of callus, and mixed genetic background of material sources. and other problems to achieve the effect of shortening the transformation period, genotype uniformity, and improving the efficiency of plant genetic transformation

Active Publication Date: 2015-12-23
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the switchgrass genetic transformation systems reported so far are less than 10% efficient
Although there are very few switchgrass genetic transformation systems whose efficiency exceeds 10%, their reproducibility and stability are not strong, and the genetic background of the material source is mixed
This is mainly because switchgrass is a self-incompatible plant, and each seed represents a different genotype. Therefore, the use of mixed seed callus will inevitably result in uneven quality of callus, which will not only affect the stability of genetic transformation efficiency , and the obtained transgenic plants have different genetic backgrounds, potentially affecting their subsequent analysis and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant polygene genetic transformation method
  • Plant polygene genetic transformation method
  • Plant polygene genetic transformation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: The establishment of the embryogenic callus line of switchgrass single genotype with high quality and high Agrobacterium infection efficiency, which comprises the following steps:

[0041] 1) After sterilizing the mature seeds of switchgrass with 3% (W / V) calcium hypochlorite for 2 hours, wash them with sterile distilled water 3 times (5 minutes each time), then put them in the refrigerator at 4°C overnight, and continue to use them the next day 5% (W / V) calcium hypochlorite was sterilized for 1.5 hours, then washed 3 times with sterile distilled water (5 minutes each time), inoculated on the callus induction medium (MSD5), and each seed was Numbering, incubator temperature 25±2°C, dark culture for 6-7 weeks, to obtain callus.

[0042] 2) The callus obtained in step (1) is visually screened, classified according to the morphology and softness and hardness of the callus, and the embryogenic callus with light yellow, loose structure and warm luster is select...

Embodiment 2

[0056] Embodiment 2: High-efficiency acquisition of transgenic switchgrass plants containing multiple exogenous genes, its main features include the following steps:

[0057] 1) The binary vectors containing pANDA-PvCOMTRi and pANIC6E-OsmiR156OE ( figure 2 B and C) Agrobacterium tumefaciens AGL1 was streak-inoculated on LB solid medium supplemented with 50mg / L rifampicin and 50mg / L kanamycin, cultivated overnight at 28°C, and then picked a single colony and inoculated in LB supplemented with 50mg / L rifampicin and 50mg / L kanamycin liquid medium, 28 ° C shaker (200rpm) overnight culture to OD 600 reach 0.6, then add acetosyringone to a final concentration of 200 μmol / L, and continue culturing for 2 h to OD 600 Reach 0.8-1.0, 3500rpm, centrifuge at 20°C for 15 minutes to collect the Agrobacterium cell pellet, and use MSD3 liquid medium to resuspend the cell to adjust the OD 600 to 0.6, and then the above-prepared Agrobacterium tumefaciens AGL1 bacterial solutions containing p...

Embodiment 3

[0070] Embodiment 3: Molecular identification of transgenic switchgrass positive plants containing multiple exogenous genes, its main features include the following steps:

[0071] From the transgenic switchgrass plants grown in the greenhouse for 1 month, the top 8-9cm leaves were taken and cut into 3-4cm segments, and the 2×CTAB method was used (Zhang Xiaoxiang et al., A modified CTAB method for rapid extraction of wheat genomic DNA, China Agricultural Science Bulletin, 2012,28:46-49) to extract DNA, and perform PCR amplification of exogenous genes / sequences (hph, nptII, COMT-RNAi, bar, gus-plus and OsmiR156), and identify positive transgenic switchgrass plants ( Figure 4 ).

[0072] The PCR primer sequences for the detection of exogenous genes / sequences (hph, NPTII, COMT-RNAi, bar, gus-plus and OsmiR156) are respectively:

[0073] hph3: AAGGAATCGGTCAATACACTACATGG

[0074] hph4: AAGACCAATGCGGAGCATATACG

[0075] nptIIF: CGTCCTTTGCTCGGAAGAGTATGAA

[0076] nptIIR: GACGCAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant polygene genetic transformation method, and belongs to the technical field of plant biological engineering. The method comprises establishing a single-genotype high-quality high-agrobacterium-infection-rate embryonic callus line; and infecting the above callus line by using grobacterium with different binary vectors, and performing double-antibody screening to obtain a transgenic positive plant containing multiple different exogenous genes. The method is mainly used to solve the problem that plant is difficult for genetic transformation and multiple-property comprehensive improvement. Experiment data show that the method can help to successfully obtain the positive transgenic plant possessing the single genotype background within 4-5 months, the genetic transformation efficiency is up to 60%, the target of converting 200 gene vectors per person per year can be realized, and the working efficiency of generating 3000 independent positive transgenic plants containing multiple different exogenous target genes can be provided.

Description

technical field [0001] The invention belongs to the technical field of plant bioengineering, and in particular relates to a method for plant polygene genetic transformation, in particular to a method for plant polygene genetic transformation. Background technique [0002] Energy grasses represented by switchgrass and Miscanthus are C4 perennial tall herbaceous energy plants, rich in lignocellulosic biomass, with large yields, strong adaptability, and do not occupy arable land, which is in line with the development of biomass energy. Compete with food for land" is the basic national policy. The current main energy grass varieties have accumulated a large amount of data and rich experience in terms of planting and farmland management, as well as in the field of breeding and genetic improvement. At the same time, energy grass has strong adaptability and wide geographical distribution. In addition, the whole genome sequences of switchgrass and Miscanthus have basically been de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/00
Inventor 付春祥吴风燕曹英萍王增裕周功克
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com