Plant polygene genetic transformation method
A genetic transformation, multi-gene technology, applied in the direction of plant gene improvement, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems affecting the stability of genetic transformation efficiency, uneven quality of callus, and mixed genetic background of material sources. and other problems to achieve the effect of shortening the transformation period, genotype uniformity, and improving the efficiency of plant genetic transformation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1: The establishment of the embryogenic callus line of switchgrass single genotype with high quality and high Agrobacterium infection efficiency, which comprises the following steps:
[0041] 1) After sterilizing the mature seeds of switchgrass with 3% (W / V) calcium hypochlorite for 2 hours, wash them with sterile distilled water 3 times (5 minutes each time), then put them in the refrigerator at 4°C overnight, and continue to use them the next day 5% (W / V) calcium hypochlorite was sterilized for 1.5 hours, then washed 3 times with sterile distilled water (5 minutes each time), inoculated on the callus induction medium (MSD5), and each seed was Numbering, incubator temperature 25±2°C, dark culture for 6-7 weeks, to obtain callus.
[0042] 2) The callus obtained in step (1) is visually screened, classified according to the morphology and softness and hardness of the callus, and the embryogenic callus with light yellow, loose structure and warm luster is select...
Embodiment 2
[0056] Embodiment 2: High-efficiency acquisition of transgenic switchgrass plants containing multiple exogenous genes, its main features include the following steps:
[0057] 1) The binary vectors containing pANDA-PvCOMTRi and pANIC6E-OsmiR156OE ( figure 2 B and C) Agrobacterium tumefaciens AGL1 was streak-inoculated on LB solid medium supplemented with 50mg / L rifampicin and 50mg / L kanamycin, cultivated overnight at 28°C, and then picked a single colony and inoculated in LB supplemented with 50mg / L rifampicin and 50mg / L kanamycin liquid medium, 28 ° C shaker (200rpm) overnight culture to OD 600 reach 0.6, then add acetosyringone to a final concentration of 200 μmol / L, and continue culturing for 2 h to OD 600 Reach 0.8-1.0, 3500rpm, centrifuge at 20°C for 15 minutes to collect the Agrobacterium cell pellet, and use MSD3 liquid medium to resuspend the cell to adjust the OD 600 to 0.6, and then the above-prepared Agrobacterium tumefaciens AGL1 bacterial solutions containing p...
Embodiment 3
[0070] Embodiment 3: Molecular identification of transgenic switchgrass positive plants containing multiple exogenous genes, its main features include the following steps:
[0071] From the transgenic switchgrass plants grown in the greenhouse for 1 month, the top 8-9cm leaves were taken and cut into 3-4cm segments, and the 2×CTAB method was used (Zhang Xiaoxiang et al., A modified CTAB method for rapid extraction of wheat genomic DNA, China Agricultural Science Bulletin, 2012,28:46-49) to extract DNA, and perform PCR amplification of exogenous genes / sequences (hph, nptII, COMT-RNAi, bar, gus-plus and OsmiR156), and identify positive transgenic switchgrass plants ( Figure 4 ).
[0072] The PCR primer sequences for the detection of exogenous genes / sequences (hph, NPTII, COMT-RNAi, bar, gus-plus and OsmiR156) are respectively:
[0073] hph3: AAGGAATCGGTCAATACACTACATGG
[0074] hph4: AAGACCAATGCGGAGCATATACG
[0075] nptIIF: CGTCCTTTGCTCGGAAGAGTATGAA
[0076] nptIIR: GACGCAGA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com