Design and synthesis method of nucleic acid coding probes for high-throughput sequencing

A coding and nucleic acid technology, which is applied in the design and synthesis of nucleic acid coding probes, can solve the problems of complex sequence modification process, difficulty in corresponding coding sequences to cells, coding sequences only to separate cells, etc., and achieve convenient, fast, accurate and accurate decoding Reliable sequencing results, reducing the troublesome effect of bioinformatics analysis

Pending Publication Date: 2021-12-03
TSINGHUA UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

First, excessive pursuit of throughput leads to too small Hamming distance between sample coding sequences, which is prone to coding recognition errors
Second, the coding sequence only seeks to separate cells, and it is difficult to map specific coding sequences to cells, resulting in a lack of phenotypic information for downstream cell analysis
The sequence modification process of probes is complex and costly; especially for coded probes, the long and diverse sequences mean that the long sequences of various coded probes need to be modified, which further increases the difficulty
Under such circumstances, traditional sequence synthesis methods not only greatly increase the cost, but also fail to obtain high-quality probe sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Design and synthesis method of nucleic acid coding probes for high-throughput sequencing
  • Design and synthesis method of nucleic acid coding probes for high-throughput sequencing
  • Design and synthesis method of nucleic acid coding probes for high-throughput sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1, Design of High-throughput Sequencing Nucleic Acid Encoding Probe

[0072] 1. Schematic diagram of the structure of high-throughput sequencing nucleic acid-encoded probes figure 1 , including the following components from the 5' end:

[0073] 1) Sequencing Adapters

[0074] The embodiment of the present invention uses Illumina's next-generation sequencing, therefore, the sequencing adapter is a P7 sequencing adapter (5'-CAAGCAGAAGACGGCATACGAGAT-3', sequence 1).

[0075] A space sequence is connected to the 5' end of the sequencing adapter (in the embodiment of the present invention, the space sequence is TTTTTTT, generally 5-10 Ts are appropriate), and the first base T of the space sequence is subjected to 5 The biotin modification at the 'end, the purpose of this space sequence is to provide a space for the connection of the probe to the streptavidin-modified magnetic beads during capture, so as to facilitate the connection of primers in the subsequent PCR ...

Embodiment 2

[0099] Embodiment 2, the establishment of nucleic acid coding probe synthesis method

[0100] After determining the structural design of the encoded probe and the resolution and synthesis scheme, it is necessary to explore and optimize the specific synthesis method and conditions of the encoded probe. The schematic diagram of T4 DNA ligase synthesis of nucleic acid-encoded probes is as follows figure 2 As shown, by splitting the long sequence of the complete nucleic acid-encoded probe into two short sequences (P1 and P2) to be synthesized separately, the two parts can be synthesized into a complete capture probe under the action of T4 DNA ligase.

[0101] Take the following nucleic acid-encoded probe as an example (without UMI sequence, this is because sanger sequencing needs to determine the sequence, and the verification test does not need to add UMI):

[0102] TTTTTTTCAAGCAGAAGACGGCATACGAGAT CGTGAT GTGACTGGAGTTCAGACG(P1)TGTGCTCTTCCGATCTCGACACGGTTTGGGCCNNNNNNNNNNTTTTTTTT...

Embodiment 3

[0134] Example 3, Design of Nucleic Acid Encoded Probe and Experimental Verification of Synthesis Scheme

[0135] 1. Design of nucleic acid-encoded probes

[0136] According to the scheme of embodiment 1 one, design and synthesize the nucleic acid coded probe:

[0137]The nucleic acid-encoded probe is obtained by connecting P1 in Table 1 to P2 in Table 2, and the last base of p1 is adjacent to the first base of p2.

[0138] For example: P1-A in Table 1 is respectively connected to P2-1 to P2-96 in Table 2 to form 96 nucleic acid-encoded probes;

[0139] P1-B in Table 1 is respectively connected to P2-1 to P2-96 in Table 2 to form 96 nucleic acid-encoded probes;

[0140] P1-C in Table 2 are respectively connected to P2-1 to P2-96 in Table 2 to form 96 nucleic acid-encoded probes;

[0141] P1-D in Table 3 are respectively connected to P2-1 to P2-96 in Table 2 to form 96 nucleic acid-encoded probes;

[0142] In the embodiment of the present invention, a total of 384 nucleic a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a design and synthesis method of nucleic acid coding probes for a high-throughput sequencing library construction process. The invention provides a nucleic acid coding probe group which is composed of a plurality of nucleic acid coding probes, wherein each nucleic acid coding probe comprises a linker sequence, a plurality of sample coding systems, a Read2 sequence, a UMI sequence and a sample capture sequence; the sample coding systems of each nucleic acid coding probe are composed of different sample tag sequences and different micro-pit coding sequences; the sample coding systems of each nucleic acid coding probe are different; the sample tag sequences and the micro-pit coding sequences are spaced by the Read2 sequence; the length of each micro-pit coding sequence is greater than that of each sample tag sequence; and the number of different bases in different micro-pit coding sequences is greater than 2. The coding probe design greatly enhances the coding throughput, and supports synchronous sequencing of more samples.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for designing and synthesizing a nucleic acid-encoded probe, in particular to a method for designing and synthesizing a nucleic acid-encoded probe used in the process of constructing a high-throughput sequencing library. Background technique [0002] High-throughput transcriptome sequencing has strong technical advantages. Transcriptome refers to the collection of all transcripts in a cell, and their number is usually determined by the period and physiological conditions of the cell. Transcriptome sequencing can help researchers more fully understand and understand the function of genes, the mechanism of action of signaling pathways, the molecular composition of cells or tissues, and the pathogenesis of diseases. Compared with other transcriptome research methods (such as hybridization detection method), transcriptome sequencing has the following advantages: 1. Wide detection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/6869
CPCC12N15/11C12Q1/6869C12Q2535/122C12Q2521/501
Inventor 刘鹏吴俣帅
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap