Method for creating high-carotenoid sweet corn by using gene editing technology

A technology of gene editing and carotene, applied in the field of genetic engineering, can solve the problems of gene redundancy, time-consuming, limit the application effect of improved materials, etc., and achieve the effect of increasing the content and sweetness

Active Publication Date: 2022-07-05
JILIN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The creation of traditional high-carotene sweet corn materials is mainly through the method of backcrossing, which often requires 6 backcrossing generations, which is not only time-consuming, but also often accompanied by gene redundancy, which leads to the introduction of some non-target traits and limits the improvement The application effect of the material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating high-carotenoid sweet corn by using gene editing technology
  • Method for creating high-carotenoid sweet corn by using gene editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of gene editing vector

[0046] (1) starch debranching enzyme gene ZmSu1, its nucleotide sequence is as follows:

[0047] ATGGCGCAGCAGCTCCCCTGCGTCTCGTCGCCGCGCCCGCTGCTCGCCGTGCCCGCGGGCCGGTGGCGCGCCGGCGTGCGGGGCCGGCCCAATGTGGCGGGACTGGGGCGGGGGCGGCTGTCTCTCCACGCCGCCGCCGCGCGGCCCGTGGCCGAGGCGGTGCAGGCGGAGGAGGACGACGACGACGACGACGAGGAGGTGGCCGAGGAGAGGTTCGCGCTGGGCGGCGCGTGCCGGGTGCTCGCGGGAATGCCCGCGCCGCTCGGCGCCACCGCGCTCCGCGGCGGTGTCAACTTCGCCGTCTACTCCAGCGGTGCCTCCGCCGCGTCGCTGTGCCTCTTCGCTCCCGGCGACCTCAAGGCGGATAGGGTGACCGAGGAGGTGCCCCTCGATCCCCTGCTCAACCGAACGGGAAACGTGTGGCACGTGTTCATCCACGGGGACCAGCTGCACGGCATGCTCTACGGATACAGGTTCGATGGCGTGTTCGCCCCTGAGCGCGGACAGTACTACGATGTGTCCAACGTTGTGGTGGATCCATACGCTAAGGCAGTGGTAAGCCGAGGTGAATATGGTGTGCCTGCGCCTGGTGGTAGTTGTTGGCCTCAAATGGCTGGTATGATCCCTCTTCCCTATAATAAGTTTGATTGGCAAGGTGACCTACCCCTTGGGTACCATCAGAAGGACCTTGTCATATATGAAATGCATTTGCGTGGATTCACAAAGCACAACTCAAGCAAGACAAAACACCCAGGAACTTACATTGGTGCTGTGTCAAAGCTTGACCATCTAAAGGAACTTGGAGTGAACTGTATAGAGCTAATGCCCTGCCATGAGTTCA...

Embodiment 2

[0090] Example 2 The gene editing vector was transformed into Agrobacterium LBA4404

[0091] 1) CaCl 2 Preparation of Agrobacterium tumefaciens competent cells

[0092] (1) From the YEP plate (Rif R ,Str R ), pick a fresh LBA4404 single colony and inoculate it in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, 28°C, 220rpm shaking culture overnight for 24-36h;

[0093] (2) Take 2ml of overnight activated bacterial liquid in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and cultivate the bacterial liquid OD at 20°C 600 to about 0.4 to 0.6;

[0094] (3) Transfer the bacterial liquid to an ice-precooled 50 mL sterile centrifuge tube, ice bath for 30 min, centrifuge at 4,000×g for 10 min at 4°C, and enrich the bacterial cells;

[0095] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspend the bacterial cells, take an ice bath for 30 min, centrifuge at 4,000 × g for 10 min at 4 °C, and enrich the bacterial cells;

[0096] (5) Pre-chill 0.05M CaCl wi...

Embodiment 3

[0110] Example 3 Maize genetic transformation

[0111] (1) The material for embryo extraction was the corn inbred line C01. The young maize embryos were observed on the ninth day after pollination. When the embryos grew to about 1.5 mm, the ear was taken back to the laboratory for embryo extraction.

[0112] (2) Prepare an Agrobacterium infection solution, and the activated Agrobacterium (Agrobacterium tumefaciens containing pBUE411-2gR-ZmSu1-ZmIsa2, or Agrobacterium tumefaciens containing pBUE411-2gR-ZmIsa3-ZmZpu1) in YEB liquid medium Shake bacteria to a specific concentration (OD 550 = 0.5), collect the cell pellet by low-speed centrifugation, and then use inf (per liter composition: N6 salt and vitamin (sigma) 2 g, sucrose 68.5 g, glucose 36 g, L-proline 0.7 g, MES 0.5 g, 1 mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium to resuspend, shake at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4.

[0113] (3) Wash the immature embryos ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating high-carotenoid sweet corn by using a gene editing technology, and belongs to the technical field of gene engineering. According to the method for creating the high-carotenoid sweet corn by using the gene editing technology, corn ZmSu1, ZmIsa2, ZmIsa3 and ZmZpu1 genes are subjected to gene editing at the same time through the CRISPR / Cas9 technology, mutant materials containing target gene mutation fragments are obtained through further screening, and the materials with sweetened grains and increased carotenoid content have important breeding value.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for creating high carotenoid sweet corn by using gene editing technology. Background technique [0002] Sweet corn is the main source of edible corn. According to hereditary characteristics, sweet corn can be divided into 4 types: ordinary sweet, super sweet, crisp sweet and enhanced sweet. Among them, Putian is controlled by a single recessive gene Zmsu1, the total sugar content of its endosperm is 2-3 times that of common maize, and the content of water-soluble polysaccharide (WSP) is higher. Sweet corn is rich in nutrients, high in vitamins, free amino acids and minerals, and has a balanced amino acid composition. The lysine content is equivalent to high lysine corn. Increasing the carotenoid content of sweet corn can effectively enhance the nutritional quality of sweet corn. [0003] Carotenoids are a class of important natural pigments with unique stru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/84C12N15/54A01H5/00A01H6/46
CPCC12N15/825C12N15/8245C12N15/8218C12N9/107C12Y204/01018
Inventor宋广树吕庆雪周迎鑫孙蕾周德龙
OwnerJILIN ACAD OF AGRI SCI