A method of using gene editing technology to create corn high stalk material

A gene editing and corn technology, applied in the field of genetic engineering, can solve the problems of gene redundancy, limit the application effect of improved materials, and take a long time, and achieve the effect of increasing plant height.

Active Publication Date: 2022-06-24
JILIN ACAD OF AGRI SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditional high-stalk corn is mainly obtained through backcrossing, often requiring 6 backcrossing generations, which is not only time-consuming, but also often accompanied by gene redundancy, which leads to the introduction of some non-target traits and limits the application effect of improved materials

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of using gene editing technology to create corn high stalk material
  • A method of using gene editing technology to create corn high stalk material

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of gene editing vector

[0036] (1) The gene that controls the plant height of maize is the ZmGA2ox3 gene, and its nucleotide sequence is as follows:

[0037]ATGGTGGTGCTCGCCAAACCGCCTGTCGTCGACCAGATCCCGCTCC TGCGGTCCCCGGGCCCCAGGGACAGCTTCTCGGGAGTGCCGGTCGTCG ACCTGTCCAGCCACGGCGCGGCGCGGGCGATCGTCGACGCCTGCGAGCGCTTCGGGTTCTTCAAGGTCGTCAACCACGGCGTGGCCGCGGCCACCAT GGACAGGGCCGAGTCCGAGGCCGTCAGGTTCTTCGCGCAGGCGCAGGC GGACAAGGACCGCGCGGGGCCGGCGTACCCGTTCGGGTACGGCAGCAA GCGGATCGGGCTCAATGGCGACATGGGGTGGCTCGAGTACCTCCTCCT CGCCGTCGACGCCGCGTCGCTCTCCGACGCCTGCCCCGTGCCCTCCAGC GCCGCGTTCCGGAGCGCGCTGAACGAGTACGTCGCGGCCGTGCGGAAG GTGGCGGCGCGTGTGCTGGAGGCGATGGCGGAGGGCCTGGGCATTGCG GACGCGGACGCGCTGAGCTCCATGGTGAGCGGCGCCGGGAGCGACCAG GTGTTCCGCGTGAACCACTACCCGCCCTGCCCCGCGCTGCAGGGCCTGG GCTGCAGCACCACGGGCTTCGGCGAGCACACCGACCCGCAGATCATCT CCGTGCTCCGCTCCAACGGCACCTCCGGCCTGCAGATCGCGCTCCGCGA CGGCGCGCAGTGGGTCTCCGTGCCCTCCGACCGCGACGCCTTCTTCGTT AACGTCGGCGACTCGTTGCAGGTGCTGACCAACGGGAGGTTCAGGAGC GTGAAGCACCGGGTGGTGA...

Embodiment 2

[0055] Example 2 The gene editing vector was transformed into Agrobacterium LBA4404

[0056] 1) CaCl 2 Preparation of Agrobacterium tumefaciens competent cells

[0057] (1) From the YEP plate (Rif R ,Str R ), pick a fresh single colony of EHA105 and inoculate it in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, 28°C, 220rpm shaking culture overnight for 24-36h;

[0058] (2) Take 2ml of overnight activated bacterial liquid in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and cultivate the bacterial liquid OD at 20°C 600 to about 0.4 to 0.6;

[0059] (3) Transfer the bacterial liquid to an ice-precooled 50 mL sterile centrifuge tube, ice bath for 30 min, centrifuge at 4,000×g for 10 min at 4°C, and enrich the bacterial cells;

[0060] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspend the bacterial cells, take an ice bath for 30 min, centrifuge at 4,000 × g for 10 min at 4 °C, and enrich the bacterial cells;

[0061] (5) Pre-chill 0.05M CaCl ...

Embodiment 3

[0074] Example 3 Maize genetic transformation

[0075] (1) The embryonic material was the corn inbred line C01, and the young maize embryos were observed on the ninth day after pollination. When the embryos grew to about 1.5 mm, the ear was taken back to the laboratory for embryo extraction.

[0076] (2) Prepare the Agrobacterium infection solution, when the activated Agrobacterium is shaken to a specific concentration (OD) in the YEB liquid medium550 = 0.5), collect the cell pellet by low-speed centrifugation, and then use inf (per liter composition: N6 salt and vitamin (sigma) 2 g, sucrose 68.5 g, glucose 36 g, L-proline 0.7 g, MES 0.5 g, 1 mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium to resuspend, shake at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4.

[0077] (3) The immature embryos taken out in (1) were washed twice with inf+AS (same as above) liquid medium, and then Agrobacterium infection solution was added to infect for 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating tall corn stalk materials by using gene editing technology, which belongs to the technical field of genetic engineering. The invention discloses a method for creating corn high stalk materials using gene editing technology, which uses CRISPR / Cas9 technology to edit the corn ZmGA2ox3 gene, and further screens to obtain mutant materials lacking the function of the target gene. These corn high stalk materials have important breeding value.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for creating high-stalk maize materials by using gene editing technology. Background technique [0002] Corn is an important food, feed, industrial raw material and biomass energy crop. Biological yield, grain yield and quality are all targeted traits in maize genetics and breeding. Plant height is closely related to maize grain yield and biological yield, and is an important yield-related trait. Modification of plant type can increase maize biomass. Plant height is an important factor constituting plant type and is highly correlated with plant biomass. Increasing the plant height can increase the biological yield of maize and improve the application value of maize in biomass energy and silage. [0003] Gibberellin (GA) is an essential endogenous hormone that regulates and controls plant growth. Mutations of gibberellin metabolizing enzymes can cause chan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/84C12N15/55C12N15/53A01H5/04A01H6/46
CPCC12N15/8205C12N15/8218C12N15/8261C12N15/8297C12N9/22C12N9/0071C12Y114/11013
Inventor宋广树吕庆雪李毅丹孙蕾高嵩
OwnerJILIN ACAD OF AGRI SCI