Method for creating corn dwarfing material based on Zm00001d008708 gene
A corn and dwarfing technology, applied in the field of genetic engineering, can solve the problems of reduced yield, lodging, and long time consumption, and achieve the effect of reducing plant height
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The construction of embodiment 1 gene editing vector
[0034] (1) The gene controlling the plant height of maize is the Zm00001d008708 gene, and its nucleotide sequence is as follows:
[0035]ATGAACGCGTCGCAGTTCATGGACAAGCAGATCCTCGGCCTGGCTGCCTCCGCTTCCCCCTCCGGCGGCGGCGCGGGGGGCGGTGGGGGTGTGGATCTCAGCGATCTGATGATACCGATCCCCCAGGAGGACGCCGAGAACCGCCTCGGTCGCCGGCGTAGCAGCACCAGCGTCAACGGAACCGCAGACGACATGCTACCCAGTTATGACTTCCAGCCCATCCGCACTAGTGGCGGCGCCGCGGCCGCCGCCGCGCCTCAGGCCTCGTGGGGGTCGCTCGACTCCAAGGCACCCTCTGCCTCATACAACCTCAAGAGTGCTGGTATATTGGAGCCGCATGTGCTGAAGAAAGTTAGTCATGAGGAAGACAAGAGTAACTTTCCTACAGTTACTATTGCGGATATTGATCGAACCATGAAGAAGTACTCTGATAACCTTTTGCATGCACTGGAAGGTGTAAGCTCAAGGCTTTCACAGATGGAGGGTAGAACACACCAACTCGAAAACTCTGTTGACGAGTTGAAGTTAACAATCGGTAACTATAATGGTAGCACTGATGGAAAACTGAGGAACCTTGAGAACATGCTCAGGGAGGTCCAAGCAGGTGTGCAGATTTTGCGAGACAAGCAGGAAATTGTCGAGACACAGCTCCACCTTGCGAAGCTCCAGACAAACAAAACCGATGGCCAATCATCAGAAAATAGTGGGTCTGGACAGGCTGGTTTACAGCAGCAGCCGGTGGTTCCTCCACAAGCAGCCATTCAGCCACAACAAGTCCTAACCCCTTCGCAACC...
Embodiment 2
[0053] Example 2 Gene Editing Vector Transformed into Agrobacterium LBA4404
[0054] 1) CaCl 2 Agrobacterium tumefaciens Competent Cells
[0055] (1) From the YEP tablet (Rif R ,Str R ) to inoculate a fresh single colony of LBA4404 in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, culture at 28°C and shake at 220rpm overnight for 24-36h;
[0056] (2) Take 2ml of overnight activated bacterial solution in the logarithmic growth phase, inoculate it in 50mL YEP liquid medium, and culture the bacterial solution OD at 20°C 600 to about 0.4~0.6;
[0057] (3) Transfer the bacterial solution to a 50 mL sterile centrifuge tube pre-cooled with ice, bathe in ice for 30 min, centrifuge at 4,000×g for 10 min at 4°C to enrich the bacterial cells;
[0058] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspended cells, ice-bathed for 30 minutes, centrifuged at 4,000×g for 10 minutes at 4°C to enrich the cells;
[0059] (5) Pre-cool 0.05M CaCl with 1mL ice 2 Resuspend the bacteria, s...
Embodiment 3
[0072] Embodiment 3 Maize genetic transformation
[0073] (1) The material for embryo extraction was the maize inbred line Zheng 58. The immature corn embryos were observed on the ninth day after pollination, and when they grew to about 1.5 mm, the ears were taken back to the laboratory for embryo extraction.
[0074] (2) Prepare the Agrobacterium infection solution, and when the activated Agrobacterium is shaken in YEB liquid medium to a specific concentration (OD 550 =0.5), low-speed centrifugation collects the thalline precipitation, then with inf (per liter composition: N6 salt and vitamin (sigma) 2 grams, sucrose 68.5 grams, glucose 36 grams, L-proline 0.7 grams, MES 0.5g, 1mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium resuspended, shake the bacteria at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4 is enough.
[0075] (3) Wash the immature embryos taken out in (1) twice with inf+AS (same as above) liquid medium, then add Agrob...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

