Phosphatases with improved phytase activity

A phytase and phosphatase technology, which can be used in plant genetic improvement, hydrolase, biochemical equipment and methods, etc., and can solve problems such as instability hindering practical application.

Inactive Publication Date: 2003-04-23
CORNELL RES FOUNDATION INC
View PDF13 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the cost of supplementing the limited commercially available phytases and the instability of the enzyme's activity to the heat of feed pelleting hampers the practical use of the enzyme in livestock

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phosphatases with improved phytase activity
  • Phosphatases with improved phytase activity
  • Phosphatases with improved phytase activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Embodiment 1

[0052] Example Example 1 Materials and methods used in Examples 2-6

[0053] Expression of r-AppA The appA gene was obtained from Escherichia coli BL21 strain transformed with the expression vector pAPPA1(20) (Genebank Accession No. M58708). A 1.35 kb DNA fragment containing the appA coding region was amplified by PCR according to the manufacturer's instructions (Perkin Elmer). Primers are derived from the 5' and 3' regions of this nucleotide sequence (18), and said primers include: E2 [forward: 242-252]: 5'GGAATTCCAGAGTGAGCCGGA3' (SEQ.ID.NO.2); and K2 [reverse: 1468-1490]: 5'GGGGTACCTTACAAACTGCACG3' (SEQ.ID.NO.3). Both primers were synthesized by the Cornell University Oligonucleotide Synthesis Facility (Ithaca, NY). The amplified product was excised from 1% agarose gel and eluted with GENECLEAN II kit (Bio101). The purified fragment was first cloned into pGEM T-easy vector (Promega), and then inserted into the yeast expression vector pPIcZαA (In...

Embodiment 2

[0057] In X33 transformed with the appA gene, more than 30 colonies expressed extracellular phytase activity that hydrolyzes sodium phytate. Colony 26 had the highest activity of this enzyme (88 U / ml) and was selected for further studies. After elution of r-PhyA and r-AppA samples from the DEAE-agarose column, 45 fractions of 4 ml each were collected for analysis of phytase activity. The phytase specific activities of r-PhyA and r-AppA of the fractions used for proteolysis were 9.6 U / mg protein and 8.1 U / mg protein, respectively. Example 3 Effects of Trypsin Digestion on the Phytase Activities of Two Enzymes

Embodiment 3

[0058] After 2 hours of trypsinization, there was a significant difference in remaining phytase activity between r-PhyA and r-AppA ( Figure 1A ). Although at trypsin / phytase ratios of 0.001 and 0.005, both enzymes retained more than 85% of their initial activity; at said ratios of 0.01 and 0.025, respectively, r-AppA lost its 64% and 74% of initial activity. At the same time, r-PhyA lost only 14% and 23% of its initial activity, respectively, correspondingly. Since the sensitivity of these two enzymes to trypsinization differs significantly at the ratio of 0.01, time course studies were performed at this ratio. Trypsinization up to 2 hours, r-PhyA still retained 90% of its original activity ( figure 2 ). In comparison, r-AppA lost 64%, 77%, 87% and 95% of its initial activity after 1 min, 5 min, 30 min and 120 min of digestion, respectively. Example 4 Effects of Pepsin Digestion on the Phytase Activities of Two Enzymes

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The present invention provides phosphatases with improved phytase activity. The invention provides proteolytic fragments of phosphatase having improved phytase activity. A recombinant gene encoding a phosphatase fragment having improved phytase activity is also provided. The invention also includes a method of increasing the phytase activity of phosphatase by treating the phosphatase with a protease. In addition, the invention provides a new phosphatase, AppA2, having improved properties.

Description

[0001] This application claims the benefit of US Provisional Patent Application Serial No. 60 / 127,032, filed March 1, 1999. Background of the invention [0002] Phytases are phytate phosphohydrolases that catalyze the stepwise removal of inorganic orthophosphate from phytate (1). There are two types of phytases. One class is called 3-phytases (EC.3.1.3.8), which initiate the removal of phosphate groups at positions 1 and 3 of the inositol ring. Another class is called 6-phytases (EC.3.1.3.26), which first release the phosphate at position 6 of the ring. Although phytases have not been identified from animal tissues, plants commonly contain 6-phytases and a variety of microorganisms including bacteria, filamentous fungi and yeasts produce 3-phytases (2-9). Since more than 70% of the total phosphorus in foods or feeds derived from plants is in the form of poorly utilized phytates by monogastric animals and humans; therefore, in improving the mineral nutr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A23K1/165A23K1/18C12N9/16C12N15/55
CPCA23K1/184C12N9/16A23K1/1656A23K1/1653A23K20/189A23K10/14A23K50/30
Inventor X·雷
Owner CORNELL RES FOUNDATION INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap