Eight human miRNAs
A technology of milf-5 and milf-1, applied in the professional field of biomedicine, can solve the problems of little understanding of miRNA biological function and unclear miRNA expression distribution.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0053] Cloning and analysis of miRNA
[0054] 1. Extraction and purification of human fetal liver small RNA
[0055] Using mirVanaTM miRNA Isolation (Ambion, Austin, TX) kit to extract small RNA (≤200nt) from 30 mg fetal liver tissue, dissolve in RNase-free water, and measure RNA concentration at 260 nm.
[0056] 2. Construction of small RNA molecule cDNA library
[0057] First, poly(A) tails were added to the 3′ end of the small molecule RNA using the Poly(A) Tailing Enzyme Kit from Takara Company. Add 1.5 μg small RNA, 5 U poly(A) polymerase (Takara), 5 μl 10× buffer and 1 mmol / L ATP to the 50 μl reaction system, and react at 37°C for 30 minutes. phenol / chloroform extraction, ethanol precipitation to recover RNA. T4RNA ligase (Invitrogen) was used to add a 44nt RNA linker (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) to the 5' end of the RNA, phenol / chloroform extraction, and ethanol precipitation to recover RNA. Then use the 60nt RT anchor primer containing multi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


