Unlock instant, AI-driven research and patent intelligence for your innovation.

Eight human miRNAs

A technology of milf-5 and milf-1, applied in the professional field of biomedicine, can solve the problems of little understanding of miRNA biological function and unclear miRNA expression distribution.

Inactive Publication Date: 2006-07-12
RADIOLOGY INST ACAD OF MILITARY MEDICINE SCI PLA
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the expression distribution of miRNAs is still not very cl...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eight human miRNAs
  • Eight human miRNAs
  • Eight human miRNAs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0053] Cloning and analysis of miRNA

[0054] 1. Extraction and purification of human fetal liver small RNA

[0055] Using mirVanaTM miRNA Isolation (Ambion, Austin, TX) kit to extract small RNA (≤200nt) from 30 mg fetal liver tissue, dissolve in RNase-free water, and measure RNA concentration at 260 nm.

[0056] 2. Construction of small RNA molecule cDNA library

[0057] First, poly(A) tails were added to the 3′ end of the small molecule RNA using the Poly(A) Tailing Enzyme Kit from Takara Company. Add 1.5 μg small RNA, 5 U poly(A) polymerase (Takara), 5 μl 10× buffer and 1 mmol / L ATP to the 50 μl reaction system, and react at 37°C for 30 minutes. phenol / chloroform extraction, ethanol precipitation to recover RNA. T4RNA ligase (Invitrogen) was used to add a 44nt RNA linker (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) to the 5' end of the RNA, phenol / chloroform extraction, and ethanol precipitation to recover RNA. Then use the 60nt RT anchor primer containing multi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a miRNA sequence related to eight kinds of hepatocyte and hepatic carcinoma cells, its precursor sequence and antisense oligonucleotide sequence, and the use in preparing medicaments for treating hepatic carcinoma.

Description

technical field [0001] The invention belongs to the professional field of biomedicine, and relates to eight novel miRNAs, miRNA precursors and their antisense oligonucleotide sequences belonging to human miRNAs, and their application in the preparation of drugs for treating liver cancer. technical background [0002] miRNA (microRNA, microRNA) is a class of RNA molecules with 19-25 nt, which is produced by the processing of its precursor molecules under the action of enzymes, and its precursor sequence is generally 70-120 nt, which widely exists in organisms. Because the miRNA sequence has a certain degree of conservation in different organisms, it is generally believed that the function of miRNA is to participate in some basic processes of life, such as cell proliferation, cell death, stress response and fat metabolism during development. Much evidence shows that miRNA plays an important role in regulating gene expression in cells. (Bartel DP. MircroRNAs: Genomics, Biogene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12A61K48/00A61P35/00A61P1/16
Inventor 郑晓飞付汉江朱捷铁轶孙志贤
Owner RADIOLOGY INST ACAD OF MILITARY MEDICINE SCI PLA