K-ras oligonucleotide microarray and method for detecting K-ras mutations employing the same

An oligonucleotide, microarray technology, applied in the direction of biochemical equipment and methods, determination/inspection of microorganisms, etc.

Inactive Publication Date: 2007-05-02
NAT CANCER CENT
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, previous studies have used specialized silicon devices or complex schemes to improve their systems (Lopwz-Crapez E et al., Clin.Chem.47:186-192, 2001; Prix L et al., Clin.Chem.48:428 -435, 2002), these devices or schemes are not suitable for accurate and economical evaluation of a large number of samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • K-ras oligonucleotide microarray and method for detecting K-ras mutations employing the same
  • K-ras oligonucleotide microarray and method for detecting K-ras mutations employing the same
  • K-ras oligonucleotide microarray and method for detecting K-ras mutations employing the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1: the manufacture of K-ras oligonucleotide microarray

[0056] Eighteen oligonucleotides were designed to include all possible substitutions at the two mutant hotspot codons (codons 11 and 12) of the K-ras gene, while 2 oligonucleotides were used as wild type. All oligonucleotides are 21 base pairs, and each mismatch sequence is located in the center of the oligonucleotide, as shown in Table 1. Oligonucleotides with missense mutations at a hotspot codon are: oligonucleotides described by SEQ ID NOs.2-10 at codon 12; oligonucleotides described by SEQ ID NOs.12-20 at codon 13 Nucleotides. The oligonucleotides described by SEQ ID NOs. 1 and 11 are wild type.

[0057] SEQ ID NO.

Oligonucleotides

Sequence (5'-3')

1

12W a

GTTGGAGCTGGTGGCGTAGGC

2

12M b 1

AGTTGGAGCT TGT GGCGTAGG

3

12M2

AGTTGGAGCT AGT GGCGTAGG

4

12M3

AGTTGGAGCT CGT GGCGTAGG

5

12M4 ...

Embodiment 2

[0061] Example 2: Study of K-ras mutations with K-ras oligonucleotide microarray

[0062] (Step 1) DNA sample preparation

[0063] A total of 204 colorectal cancer patients from Seoul National University Hospital and Korea National Cancer Center were investigated for the presence of K-ras in somatic cells. Written consent was obtained from all patients. Of the 204 colorectal cancers, 103 were from the proximal colon (cecum to splenic flexure) and 101 from the distal colon (splenic flexure to rectum). Again, normal tissues from colorectal cancer patients were used as negative controls.

[0064] Genomic DNA was extracted from frozen samples using TRI reagent (Center for Molecular Research, Cincinnati, Ohio, USA) as previously described (Kim IJ et al., Clin. Cancer Res. 9:2920-2925, 2003). To generate fluorochrome-labeled DNA samples, the extracted DNA was used as a template for PCR amplification using the two pairs of primers SEQ ID NOs 21 and 22 (Metabion, Germany) as previo...

Embodiment 3

[0075] Embodiment 3: The K-ras mutation detected by the K-ras oligonucleotide microarray is indeed

[0076]In order to confirm the K-ras mutation detected by the K-ras oligonucleotide microarray of the present invention, 205 colorectal cancer samples were subjected to bidirectional sequencing analysis as previously described (Park, JH et al., Clin. Genet .64:48-53, 2003). For sequencing, previously reported primers of SEQ ID NOs: 23 and 24 were used (Lagarda H et al., J. Pathol. 193: 193-199, 2001). PCR was carried out in the same manner as described in step (1) of Example 2, but using a conventional dNTP mixture.

[0077] Bidirectional sequencing was performed using Taq dideoxy terminator cycle sequencing kit (Taq dideoxy terminator cycle sequencing kit) and ABI 3100 DNA sequencer (Applied Biosystems, Forster City, CA).

[0078] As a result, the mutation results were 100% consistent with direct sequencing, indicating that there were neither false positives nor false negativ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Since the K-ras oligonucleotide microarray of the present invention can detect K-ras mutations by applying a competitive DNA hybridization method to the oligonucleotides spotted on a solid matrix different from the previously reported method for detecting a mutation, it makes the more precise analysis and can reduce experimental cost and time. Accordingly, the K-ras oligonucleotide microarray of the present invention can be used in studies to detect K-ras mutations and unravel the signal transduction mechanism and tumorigenesis related to K-ras gene. Further, since the microarray of the present invention can be applied to other genes having mutational hot spot regions such as K-ras, it has wide applicable range.

Description

technical field [0001] The invention relates to a K-ras oligonucleotide microarray for detecting mutations in K-ras gene mutation hot spots, a manufacturing method thereof and a method for detecting K-ras mutations. Background technique [0002] K-ras is one type of ras gene that is mutated in various cancers. Mutations in the K-ras gene at codons 12 and 13 are involved in tumorigenesis by causing a functional modification of the p21-ras protein, a K-ras gene product, that transmits excessive growth signals to the nucleus, stimulating cell growth and division. The incidence of K-ras mutation is about 90% in pancreatic cancer, about 50% in colorectal cancer, and about 30% in non-small cell lung cancer. The mutation profile shows that about 85% of mutations Occurs at codons 12 and 13 (Samowitz WS et al., Cancer Epidemiol. Biomarkers Prev. 9: 1193-1197, 2000). Therefore, the identification of K-ras gene mutations has been widely used as a useful tool i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q2600/156C12Q1/6837C12Q1/6886C12Q2563/107
Inventor朴在甲金日镇姜晓贞朴在贤
OwnerNAT CANCER CENT