Unlock instant, AI-driven research and patent intelligence for your innovation.

Nuclear localization signal of lentiviral integrase and method of use thereof

a technology of lentiviral integrase and localization signal, which is applied in the direction of peptide source, biochemistry apparatus and processes, viruses/bacteriophages, etc., can solve the problems of re-assessment, challenge and/or re-assessment of the relative importance of each, and achieve inhibition or abrogation of hiv latency, inhibiting or abrogating hiv latency, and preventing the effect of re-absorption

Inactive Publication Date: 2010-04-22
THE ROCKEFELLER UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The use of the HIV-1 integrase-derived NLS enables targeted modulation of nuclear import, potentially inhibiting HIV-1 integration and pathogenesis by competing with the native integrase, thereby providing a mechanism to regulate viral entry and disease progression.

Problems solved by technology

Nevertheless, assignment and definition of the relative importance of each remains controversial.
Again, the interpretation of these results has been challenged and / or reassessed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nuclear localization signal of lentiviral integrase and method of use thereof
  • Nuclear localization signal of lentiviral integrase and method of use thereof
  • Nuclear localization signal of lentiviral integrase and method of use thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Residues in the Carboxyl-Terminus of Integrase are Determinants of Nuclear Localization

[0206]Integrase has been mutagenized extensively in the context of numerous functional studies, but a systematic set of mutants has not yet been employed to localize determinants regulating its nuclear import. To identify determinants regulating nuclear import, a fluorescent marker for assaying the subcellular localization of integrase was constructed. (FIG. 1A). The integrase coding region (HIV-1 integrase (IN) open reading frame derived from the CXCR4-tropic, HXB-2 subclone, R7 / 3 HIV strain: tttagatggaatagataaggcccaagatgaacatgagaaatatcacagtaattggagagcaatggctagtgatmaacctgccacctgtagta gcaaaagaaatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatggacaagtagactgtagtccaggaatatggcaa ctagattgtacacatttagaaggaaaagttatcctggtagcagttcatgtagccagtggatatatagaagcagaagttattccagcagaaacag ggcaggaaacagcatattttatttaaaattagcaggaagatggccagtaaaaacaatacatacagacaatggcagcaatttcaccagtgcta cggttaaggccgcctgttggtgggcgggaatcaagcagg...

example 2

The Integrase NLS is Highly Conserved Among Primate Lentiviridae, and in Particular, Among Multiple HIV Clades

[0213]Conservation of the carboxy-terminus of the integrase protein was demonstrated in multiple primate lentiviridae. Underlined residues in Table 4 of Example 1 indicate highly conserved residues among HIV-1 strains, and various SIVs (FIG. 2). The conservation is complete both in placement and sequence regarding HIV coordinants K236, R262, R263, K266, and somewhat at K240, as well. For the non-primate lentiviridae EIAV, FIV, BIV and Visna virus, the overall pattern of basic residue placement can be discerned as well. Clusters of basic residues are roughly 25-30 amino acids apart. Hydrophobic residues involved in maintaining the SH3 monomeric structure, and those involved in maintaining the SH3:SH3 dimer interface were as indicated.

[0214]520 HIV independent proviral DNA sequences representing major lade groups were subjected to BLAST analysis via the Los Alamos HIV Sequence...

example 3

The C-Terminus of HIV Integrase Contains a Transferable NLS

[0215]A hallmark of NLS functionality is the ability of an NLS-containing polypeptide to confer nuclear localization to a large protein that is otherwise cytoplasmic. To determine whether the carboxyl-terminal domain of IN contains such a transferable NLS, two large, fluorescent, chimeric proteins that are unable to enter the nucleus (pEGFP-EGFP, 59 kD and pEGFP-MBP, 74 kD) were constructed. Both proteins localized entirely to the cytoplasm of transfected cells (FIG. 6A). However, constructs comprising a nucleotide sequence encoding for the addition of the carboxyl-terminal domain of IN: gaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatccactttggaaaggaccagcaaagctcctct ggaaaggtgaaggggcagtagtaatacaagataatagtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattatggaa aacagatggcaggtgatgattgtgtggcaagtagacaggatgaggattag (SEQ ID NO: 148), spanning residues 212-288 ELQKQITKIQNFRVYYRDSRNPLWKGPAKLLWKGEGAVVIQDNSDIKVVPRR-KAKIIRDYG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides novel peptides, nucleic acids, vectors, compounds, compositions and methods for regulating nuclear import The present invention also relates to a lentiviral NLS, and methods of use thereof for inhibiting HIV pathogenesis and disease progression, and for gene delivery methods

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation of co-pending U.S. patent application Ser. No. 11 / 02399, filed Dec. 29, 2004 and claims the benefit of U.S. Provisional Application No. 60 / 532,563, filed Dec. 29, 2003, both of which are hereby incorporated herein in their entireties.FIELD OF THE INVENTION[0002]This invention provides compounds and methods for modulating nuclear import. The present invention provides HIV-1 integrase-derived molecules that stimulate, accelerate, inhibit or abrogate nuclear import. The present invention also provides a peptide comprising a C-terminal Nuclear Localization Signal sequence of an HIV-1 integrase protein, or a fragment thereof, functioning in modulating nuclear import and methods utilizing same.BACKGROUND OF THE INVENTION[0003]After fusion and entry, the Human Immunodeficiency Virus (HIV-1) must navigate its genome through the cytosol and into the nucleus of its target cells, where integration into the host's c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N7/04
CPCC07K14/005C07K2319/09C12N2740/16222C12N2740/16061C12N7/00
Inventor MUESING, MARK A.CUNNNINGHAM, TSHAKA J.
Owner THE ROCKEFELLER UNIV