Prawn antiviral growth-promoting double-function engineering strain, construct method and application
A technology for genetically engineering strains and strains, applied in the field of genetic bioengineering, and can solve problems such as high cost and cumbersome process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] The preparation of embodiment 1 carp growth hormone gene
[0066] Primers were designed according to the sequence of GH published in GenBank. gh's upstream primer prime1: GAATTC ATCAGACAACCAGCGGCTCTTCAATAATGC. (The underline is the EcoRI site), the downstream primer prime2 of gh: TCTAGA AACTCCAGGGTGCAGTTGGAATCCA (the XbaI site is underlined). PCR was performed using PMD-18-gh as a template. PCR reaction system: 10×reactionbuffer 5uL, MgCl2 3uL (1.5mM), dNTP 1uL (0.2mM), upstream and downstream primers 1uL (30pmol), Taq DNA polymerase 1uL (5U), template 4uL, add sterile water to the end The volume is 50uL. The reaction conditions of PCR were: 95°C for 5min, 94°C for 30s, 55°C for 30s, 72°C for 1min, and after 30 cycles, 72°C for 10min.
Embodiment 2
[0067] The preparation of the vp28 gene of embodiment 2WSSV
[0068] Primers were designed according to the sequence of vp28 published in GenBank. vp28 upstream primer prime3: TCTAGA ATGGATCTTTCTTTCACTTCTTTC (the XbaI site is underlined), vp28 downstream primer prime4: TCTAGA AATTGCTCGGTCTCAGTGCCAG (the XbaI site is underlined). PCR was performed using pUCm-vp28 as a template. PCR reaction system: 10×reaction buffer5uL, MgCl 2 3uL (1.5mM), dNTP 1uL (0.2mM), upstream and downstream primers 1uL (30pmol), Taq DNA polymerase 1uL (5U), template 4uL, add sterile water to a final volume of 50uL. The reaction conditions of PCR were: 95°C for 5min, 94°C for 30s, 55°C for 30s, 72°C for 1min, and after 30 cycles, 72°C for 10min.
Embodiment 3
[0069] Example 3 Recovery, purification and subcloning of PCR products
[0070] Electrophoresis the above PCR products on agarose gel (1×TAE), observe the electrophoresis with ultraviolet light, stop the electrophoresis when the DNA band to be recovered is completely separated from other bands, cut off the DNA band to be recovered with a blade under the ultraviolet light Purify the tape with a PCR product purification kit. Crush the gel in an Eppendorf tube, add 4 times the volume of the sol solution Binding Buffer, bathe in water at 65°C for 7 minutes, shake the Eppendorf tube once every 2 minutes to completely melt the gel, take 750 μl and add Put it on the column, centrifuge at 12000rpm for 1min, discard the liquid, add 300μl Binding Buffer, centrifuge to discard the liquid, add 750μl Washing Buffer, centrifuge to discard the liquid, repeat once, centrifuge the empty column at 12000rpm for 1min to dry the liquid, put the column in 1.5ml Eppendorf tube, add 30 μl sterile ddH...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap