Prawn antiviral growth-promoting double-function engineering strain, construct method and application

A technology of genetically engineered strains and strains, applied in the field of genetic bioengineering, can solve the problems of cumbersome process and high cost

Inactive Publication Date: 2007-08-15
WUHAN UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the content of fish growth hormone in the fish itself is very small, it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prawn antiviral growth-promoting double-function engineering strain, construct method and application
  • Prawn antiviral growth-promoting double-function engineering strain, construct method and application
  • Prawn antiviral growth-promoting double-function engineering strain, construct method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] The preparation of embodiment 1 carp growth hormone gene

[0067] Primers were designed according to the sequence of GH published in GenBank. gh's upstream primer prime1: GAATTC ATCAGACAACCAGCGGCTCTTCAATAATGC. (The underline is the EcoRI site), the downstream primer prime2 of gh: TCTAGA AACTCCAGGGTGCAGTTGGAATCCA (XbαI site is underlined). PCR was performed using PMD-18-gh as a template. PCR reaction system: 10×reactionbuffer 5uL, MgCl2 3uL (1.5mM), dNTP 1uL (0.2mM), upstream and downstream primers 1uL (30pmol), Taq DNA polymerase 1uL (5U), template 4uL, add sterile water to the end The volume is 50uL. The reaction conditions of PCR were: 95°C for 5min, 94°C for 30s, 55°C for 30s, 72°C for 1min, and after 30 cycles, 72°C for 10min.

Embodiment 2

[0068] The preparation of the vp28 gene of embodiment 2WSSV

[0069] Primers were designed according to the sequence of vp28 published in GenBank. vp28 upstream primer prime3: TCTAGA ATGGATCTTTCTTTCACTTCTTTC (the XbαI site is underlined), vp28 downstream primer prime4: TCTAGA AATTGCTCGGTCTCAGTGCCAG (the XbaI site is underlined).

[0070] PCR was performed using pUCm-vp28 as a template. PCR reaction system: 10×reaction buffer 5uL, MgCl2 3uL (1.5mM), dNTP 1uL (0.2mM), upstream and downstream primers 1uL (30pmol), Taq DNA polymerase 1uL (5U), template 4uL, add sterile water to the end The volume is 50uL. The reaction conditions of PCR were: 95°C for 5min, 94°C for 30s, 55°C for 30s, 72°C for 1min, and after 30 cycles, 72°C for 10min.

Embodiment 3

[0071] The recovery, purification and subcloning of embodiment 3PCR product

[0072] Electrophoresis the above PCR products on agarose gel (1×TAE), observe the electrophoresis with ultraviolet light, stop the electrophoresis when the DNA band to be recovered is completely separated from other bands, cut off the DNA band to be recovered with a blade under the ultraviolet light Purify the tape with a PCR product purification kit. Crush the gel in an Eppendorf tube, add 4 times the volume of the sol solution Binding Buffer, bathe in water at 65°C for 7 minutes, shake the Eppendorf tube once every 2 minutes to completely melt the gel, take 750 μl and add Put it on the column, centrifuge at 12000rpm for 1min, discard the liquid, add 300μl Binding Buffer, centrifuge to discard the liquid, add 750μl Washing Buffer, centrifuge to discard the liquid, repeat once, centrifuge the empty column at 12000rpm for 1min to dry the liquid, put the column in 1.5ml Eppendorf tube, add 30 μl s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a prawn white spot comprehensive virus capsule membrane protein vp28 and genetic engineering strain of carp growth hormone GH fused protein and constructing method and appliance, which comprises the following steps: extracting total RNA from glandula pituitaria of prawn; reverse- transcripting; getting GH gene; extracting WSSV from ill prawn polypide; preparing vp28 gene through PCR method; constructing shuttle plasmid pPIC6alphac-GH-vp28 with growth hormone GH gene and WSSV vp28 gene; cutting pPIC6alphac-GH-vp28 with enzyme; making to linearization; inverting yeast X33 competence cell; inducing with methanol; expressing genetic engineering fused protein GH+VP28 protein in pichia. This protein can either accelerate growth of prawn, or increases immunity and disease resistance for WSSV.

Description

technical field [0001] The invention relates to the technical field of genetic bioengineering, more specifically to a genetically engineered bacterial strain that efficiently expresses the fusion protein of prawn white spot syndrome virus (WSSV) envelope protein VP28 and carp growth hormone (GH), and also relates to a genetically engineered bacterial strain The construction method. The invention also relates to the use of the bacterial strain in the research and development of anti-virus and growth-promoting prawns. Background technique [0002] Shrimp is the main aquaculture species in the coastal countries and regions of the world. The shrimp farming industry has always been an important economic pillar industry in my country's coastal areas. my country is also one of the largest shrimp producing countries in the world. In 1987 and 1988, large-scale outbreaks of death occurred in the cultured Penaeus monodon in Taiwan, my country. This was the first so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/19C12N15/18C12N15/33A61K36/064C12R1/84
Inventor 孟小林徐进平龙燕王健鲁伟韩建山
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap