Human G209A mutant alpha-synuclein tr-gene SH-SY5Y cell

A mutant and transgenic technology, applied in genetic engineering, plant genetic improvement, cells modified by introducing foreign genetic material, etc., can solve problems such as nerve cell degeneration and recovery

Inactive Publication Date: 2007-11-21
INST OF MATERIA MEDICA CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since its pathogenesis is not yet clear, so far the disease has been treated symptomatically, and there is no radical cure that can restore nerve cell degeneration.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human G209A mutant alpha-synuclein tr-gene SH-SY5Y cell
  • Human G209A mutant alpha-synuclein tr-gene SH-SY5Y cell
  • Human G209A mutant alpha-synuclein tr-gene SH-SY5Y cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] This model is established on the basis of constructing eukaryotic expression plasmid of human G209A mutant α-synuclein gene. The specific method is as follows:

[0017] 1. Select SH-SY5Y cells, extract total RNA, and use RT-PCR method to amplify human wild-type α-synuclein gene (Fig. 1, Fig. 2).

[0018] 2. Perform T-A cloning of α-synuclein and pMD18-Tsimple vector, transform the competent cells, and conduct positive clone screening, colony PCR and sequencing identification to prove that the inserted gene is indeed α-synuclein (Figure 3).

[0019] After comparison with GeneBan, it was proved that the amplified sequence was correct. The aligned sequences are as follows:

[0020] GAGGGACTCAGTGTGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAA

[0021] AGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAA

[0022] ACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGT

[0023] AGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGA

[0024] GAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A drug screening against Parkinson's Disease and the construction of assessment platform are disclosed. The platform is supported by gene cloning technology and transfer gene technology, in vitro analog affection Baramine neuron can be used to screen provisional compound against Parkinson's Disease and leader compound. It can be used to make research for pharmacological assessment and penetrating mechanism.

Description

technical field [0001] The invention relates to the establishment of an anti-Parkinson's Disease (Parkinson's Disease) drug screening and evaluation platform in China. Supported by gene cloning technology and transgenic technology, the platform simulates pathological dopaminergic neurons in vitro, which can be used to screen candidate compounds and lead compounds for anti-Parkinson's disease drugs, and to conduct pharmacological evaluation and in-depth mechanism research on drugs . Background technique [0002] Parkinson's disease, also known as paralysis agitants, is a neurodegenerative disease with selective loss of dopaminergic neurons in the substantia nigra of the midbrain and a significant decrease in dopamine content in the striatum. One of the degenerative diseases of the nervous system, its occurrence is the result of the synergy of genetic susceptibility and environmental harmful factors. Because its pathogenesis has not yet been understood, so far the disease is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/12C12N15/85C12N15/10C12Q1/00C12Q1/68C12P19/34
Inventor 朱海波赵大龙王晓良
Owner INST OF MATERIA MEDICA CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap