Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof

An extraction method and technology of defensins, which are applied in peptide preparation methods, chemical instruments and methods, botanical equipment and methods, etc., can solve problems such as drug resistance and environmental hazards of antibiotics, achieve low cost, abundant sources, and improve extraction efficiency effect

Inactive Publication Date: 2012-02-29
HENAN AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] Another object of the present invention is to provide a new antibacterial substance to help solve the environmental hazards and drug resistance problems of existing antibiotics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof
  • Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof
  • Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0051] The invention provides the amino acid sequence of a defensin and its polynucleotide sequence, as well as the application of the defensin.

[0052] The amino acid sequence of the active defensin can be synthesized:

[0053] Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg-Arg Leu-Cys-Phe-His-Met Glu-Ser-Trp-Ala-Gly Ser-Cys-Met -Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-GlnPro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-SerLeu-Gly-Gly-Thr

[0054] The defensin cDNA sequence is:

[0055] TCAGACAGCC AGCTGTGCAG GAACAACCAT GGCCACTGCC GGAGGCTCTG

[0056] CTTCCACATG GAGAGCTGGG CTGGGAGCTG CATGAACGGC CGCCTGCGCT

[0057] GCTGCAGGTT CTCCACCAAG CAGCCCTTTT CCAACCCTAA ACATTCAGTG

[0058] CTGCACACAG CAGAGCAGGA CCCTTCCCCA AGCCTTGGAG GGACGTGA.

[0059] A method for extracting chicken intestinal beta defensins, comprising the following steps:

[0060] Step 1: Remove the fat and contents in the posterior intestinal tract of adult chickens, we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: TCAGACAGCCAGCTGTGCAG GAACAACCAT GGCCACTGCC GGAGGCTCTG CTTCCACATGGAGAGCTGGG CTGGGAGCTGCATGAACGGC CGCCTGCGCT GCTGCAGGTTCTCCACCAAG CAGCCCTTTT CCAACCCTAA ACATTCAGTG CTGCACACAGCAGAGCAGGA CCCTTCCCCA AGCCTTGGAG GGACGTGA. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (A) collecting broken mucosa cells of chicken intestinal tract; (B) breaking vesicles; (C) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (D) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol / L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm / h, and range 20mV); (E) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (F) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (G) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.

Description

[0001] The invention relates to the technical field of mucosal immunity and biomedicine, in particular to the amino acid sequence and polynucleotide sequence of chicken intestinal beta defensin. Background technique [0002] Defensins are a basic substance produced by organisms during the defense response against pathogenic microorganisms. The molecular weight is generally between 4KD and 10KD, and they are mainly stored in small vesicles in cells. [0003] (1) Defensins play an important role in the body's defense system [0004] Animals will directly contact, ingest, and inhale thousands of pathogenic microorganisms every day without suffering from infectious diseases. This ability to resist foreign pathogenic microorganisms is mainly realized through the defense mechanism of natural immunity. Defensins are an important part of the natural defense mechanism in all species. They have broad-spectrum antibacterial activity and can kill Gram-negative and positive bacteria, fungi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/465C07K1/14
Inventor 杨玉荣姜义宝梁宏德王平利焦喜兰
Owner HENAN AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More