35 results about "Amino acid sequence analysis" patented technology

The invention discloses a high-purity earthworm activating enzyme preparation method and take it as raw material preparation. The invention through uses the monoclonal antibody technology realization earthworm activating enzyme, this method characteristic is attains the enzyme the shift strongly, the activeness is high, achieves above each milligram protein 200,000 units; After the highly effective liquid chromatography test is the sole component; Swims in the Sds- polyacrylamide gelatin electricity presents a belt, the molecular weight is 32000+ / -2000 Dalton; The amino acid sequence analysis, the N- terminal 10 amino acids sequences are: He-Val-Gly-Gly-He-Glu-Ala-Arg-Pro-Tyr, take states the high-purity earthworm activating enzyme to be allowed to make as the raw material medicine may supply to take orally, intermuscular injection, as well as the intravenous injection and the venous transfusion many kinds of ways for the medicine preparation, uses in the thrombus disease treatment.

The invention relates to an angiotensin I converting enzyme inhibitor peptide and the analogue thereof or an ACE inhibitor formed from the salt thereof, in particular to an active single peptide separated from oyster protease decomposition product and application thereof; the active peptide is with amino acid sequence of sequence table No.1. The invention adopts enzyme catalysis technology to carry out enzymolysis on the oyster protease, takes advantage of biological molecule separation technology to carry out isolation and purification on the part with stronger ACE inhibition activity; Amino acid sequence analysis is carried out on the single peptide obtained after purification and the inhibition activity and stability of the single peptide against the ACE in vivo and in vitro are studied; the result shows that the single peptide has stronger effect of lowering blood pressure. Therefore, the active single peptide and the ramification thereof or the salt thereof can be used as long-term therapy medicine for patients with elevated blood pressure or can be used as food additive to be made into health foods.

The invention relates to an anther development control gene and use thereof in realizing male sterility in Arabidopsis thaliana. An Arabidopsis thaliana male sterile mutant ahl16 is screened out from T-DNA-inserted mutant population, a gene AHL16 controlling the fertility of Arabidopsis thaliana is cloned and identified, the nucleotide sequence of the gene AHL16 is represented by SEQ ID N0.1, and genetic complement experiments prove that the AHL16 gene in a wild type can restore the male sterile phenotype. Amino acid sequence analysis and subcellular localization experiments indicate that the AHL16 gene codes proteins of an AT-hookmotif nuclear localized protein family and is located in the nucleus. In Arabidopsis thaliana, the mutation of the gene leads to complete male sterility. The gene has a very important application value in aspects of explanation of influences of the growth of the inner layers of the outer walls of microspores and the structures of the inner walls on the fertility of plants and improvement on yield by hybrid seed production.

The invention provides casein active single peptide as well as a preparation method and application thereof. An amino acid sequence is Asn-Pro-Ser-Lys-Glu-Asn-Leu. In the invention, a modern catalysis technology is used for enzymolysis, a part with strong activity for prompting yogurt fermentation and inhibiting the yogurt post-acidification is separated and purified by using a biological molecule separation and purification technology, and amino acid sequence analysis is performed for the active single peptide obtained by purifying. The active peptide has the functions of obviously shortening the yogurt fermentation time and inhibiting the yogurt post-acidification, and can be safely added into the yogurt; thereby the biological active peptide is used as yogurt fermentation addictive to improve the quality of the yogurt product.

The invention discloses a recombinant antigen for BVDV (bovine viral diarrhea virus) antibody detection and a rapid detection test strip thereof, mainly aiming at a truncated BVDV NS expression antigen for BVDV antibody detection and a rapid detection test strip for detecting BVDV antibodies. A BVDV NS protein amino acid sequence is analyzed by utilizing epitope analysis software; a fragment with the main epitope is taken; a truncated BVDV NS recombinant antigen is obtained according to the corresponding nucleotide sequence design primer through PCR (polymerase chain reaction) amplification, recombination expression carrier construction and prokaryotic expression, and can be used for BVDV antibody detection after being purified. The rapid detection test strip established based on the truncated BVDV NS antigen has the advantages of convenience in operation, rapid detection, no requirement of a special laboratory and equipment and the like, overcomes the limits of the existing detection method, and can be used for rapid detection and serum epidemiological investigation of the BVDV antibodies.

A human protein phosphatase site-2A alpha mutant gene sequence associated with lung cancer, the change from arginine to tryptophane in the polypeptide chain whose amino acid sequence is shown by SEQ ID No.2, and the process for preparing said DNA sequence are disclosed, which can be used for diagnosing and treating lung cancer.

The invention discloses a method for separating and purifying a protease capable of degrading soybean protein allergens, belonging to the technical field of protein purification. The method comprises the following step: separating and purifying the protease which is sourced from a wild strain Bacillus sp.BBE201108 and has the effect of degrading soybean protein allergens by sequentially adopting ammonium sulfate distributed precipitation, dialysis, anion exchange chromatography (Q FF) and gel filtration chromatography (Superdex 75). The protease disclosed by the invention can be successfully prepared by virtue of separation and purification, and a foundation for analyzing enzymatic properties and amino acid sequences of the protease and achieving heterologous expression research of the protease can be provided.

The invention discloses an improved protein mMet el for relieving tropomyosin sensitization response of prawns as well as a preparation method and application of the improved protein. The improved protein mMet el has an amino acid sequence shown as SEQ ID NO:1. The preparation method comprises the following steps: (1) contrasting metapenaeus tropomyosin mMet el antigen-specific epitope amino acid sequences and tropomyosin sequences of four marine fishes, performing amino acid sequence analysis, and redesigning antigen epitope amino acid residue sequences so as to obtain the amino acid sequence of the improved protein mMet el; (2) performing reverse transcription and translation so as to obtain cDNA; (3) treating and combining the obtained cDNA and vector plasmids through restriction enzymes so as to obtain a recombinant plasmid vector; (4) introducing the recombinant plasmid vector into host bacteria, and expressing the improved protein mMet el; (5) purifying, thereby obtaining a standard substance of the improved protein mMet el. The improved protein disclosed by the invention has the characteristics of high yield, stable production and low cost.

The invention provides a method for obtaining a haemonchus contortus (H.contortus) microsomal aminopeptidase gene which comprises the steps of total RNA extraction, H11 cDNA sequence clone, homology comparison and amino acid sequence analysis of H11 cDNA sequence as well as H11 genome sequence clone and structural analysis. By referring to the H11 gene cDNA sequence, the method can conveniently, completely and accurately obtain H11 genome sequence, can analyze the H11 mRNA transcription characteristic by analyzing the H11 genome sequence, and provides reliable background material and data for developing H.contortus vaccines. The haemonchus contortus (H.contortus) microsomal aminopeptidase gene that is provided by the invention can be applied to the subunit vaccine preparation that uses recombinant proteins.

A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: tcagacagcc agctgtgcag gaacaaccat ggccactgcc ggaggctctg cttccacatg gagagctggg ctgggagctg catgaacggc cgcctgcgct gctgcaggtt ctccaccaag cagccctttt ccaaccctaa acattcagtg ctgcacacag cagagcagga cccttcccca agccttggag ggacgtga. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (1) collecting broken mucosa cells of chicken intestinal tract; (2) breaking vesicles; (3) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (4) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol / L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm / h, and range 20mV); (5) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (6) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (7) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.

The invention discloses an acipenser sinensis antibacterial peptide and a preparation method and an application thereof, and particularly discloses a novel acipenser sinensis natural antibacterial peptide pen-hepcidin, an amino acid sequence for encoding a gene and an application of a protein to preparation of a medicament for treating infectious diseases and a feed additive. An antibacterial peptide gene pen-hepcidin is cloned from acipenser sinensis blood with an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method, and the DNA (Deoxyribose Nucleic Acid) sequence of the antibacterial peptide gene pen-hepcidin is shown as a sequence SEQ ID:1 in a sequence table. The amino acid sequence of a protein (pen-hepcidin) encoded by using the gene is shown as SEQ ID:3 in a sequence table. According to amino acid sequence analysis, a protein polypeptide which is similar to the antibacterial peptide is not found in a protein database, and belongs to a novel antibacterial peptide. The antibacterial peptide disclosed by the invention has antibacterial activity on a part of Gram-positive bacteria and Gram-negative bacteria, has a remarkable effect on drug-resistant strains, and can be used for preparing a medicament for treating infectious diseases or applied as antibacterial feed additives and the like.

The invention belongs to the technical field of gene engineering, and particularly relates to a gene for encoding GA20-oxoxidase and application of the gene. The gene for encoding the GA20-oxoxidase is obtained from a constructed saccharomycetes cDNA library, and the nucleotide sequence of the gene is as shown in SEQ ID No. 1. According to the gene, a GA20ox gene sequence is directly obtained froma test material, the physicochemical activity of the gene is analyzed, and the gene is used as an index for regulating and controlling dwarfing traits. The invention relates to cloning of the GA20oxoxidase gene, analysis of an amino acid sequence corresponding to the GA20ox oxidase gene, and determination of the expression quantity of the GA20ox gene through a semi-fluorescent quantitative method, and provides a new method for early pre-judging whether a test material has dwarfing traits or not. The method for determining the expression quantity of the GA20ox gene through the semi-fluorescence quantitative analysis method is simple and efficient for early pre-judging whether the test material has the dwarfing characteristic or not.

The invention discloses a preparation method of a novel estrogen receptor protein ERbetaX and an application of the ERbetaX protein, and which prepares ERbetaX protein by using molecular biological techniques; separating and purifying by adopting molecular sieve gel chromatography, ion exchange resin and silica gel chromatography; identifying and analyzing the structure through a liquid chromatography-mass spectrometry instrument, an amino acid sequence analyzer or a nuclear magnetic resonance instrument; establishing animal models of mice and rats, and carrying out toxicological experiments of ERbetaX; determining the administration dosage and the route of ERbetaX; carrying out research on the activity and pharmacokinetics of ERbetaX protein by high performance liquid chromatography (HPLC); analyzing the specificity and affinity of ligands such as estradiol (E2), Tamoxifen (TAM) and the like; studying the role and mechanism of ERbetaX in various hormone-related tumors such as breast cancer, prostate cancer, cervical cancer, ovarian cancer and colorectal cancer by biological and molecular biology experiments. The preparation method of the novel estrogen receptor protein ERbetaX hassmall toxic and side effects and low production cost, and avoids pain caused by radiotherapy and chemotherapy of patients due to surgery.

The invention provides a bioactive peptide and application thereof, and belongs to the technical field of marine organisms. According to the bioactive peptide and the application thereof, seafood mussels which are common in coastal areas in Shandong province serve as the raw materials, a biological enzymolysis technology, a chromatographic separation technology and an amino acid sequence analysis technology are adopted to prepare a new short peptide containing six amino acid through separation and purification, the amino acid sequence is identified as Phe-Thr-Tyr-Val-Pro-Gly, and meanwhile in vitro activity shows that the bioactive peptide has strong antioxidant activity. The invention aims at providing a theoretical basis for development and utilization of mussel resources.

Peptide-fragment mixtures obtained by fragmenting a sample with each of multiple enzymes which cause cleavage at different sites are subjected to mass spectrometry. De novo sequencing is performed on the obtained results to deduce partial sequence candidates for various kinds of fragments (S1 and S2). Using the fact that a specific amino acid residue should appear at the cleavage site depending on the enzyme, a partial sequence candidate including the terminal of the original amino acid sequence is extracted from a number of candidates (S6). The task of searching for and combining non-terminal partial sequence candidates including an overlapping portion is repeated (S7 and S8). The sequence candidates including the terminal are subsequently connected to the ends of the sequence obtained through the repetitive task (S9). The eventually obtained amino acid sequence is highly likely to be the correct solution (S10 and S11).

The invention discloses a rice disease-resistant gene OsSeh1 as well as a cloning method, functional identification method and application of the rice disease-resistant gene OsSeh1. A Seh1 homologous gene in rice is excavated from rice genome information, the overall-length cDNA sequence of the Seh1 homologous gene is cloned, the Seh1 homologous gene is subjected to amino acid sequence analysis, subcellular localization and expression analysis in a salicylic acid disease-resistant approach, and the resistance of a transgenic sun plant to rice sheath blight is identified, so that the function of the gene Seh1 in rice disease resistance is primarily determined, and the genetic theoretical basis is provided for the breeding of broad-spectrum and disease-resistant rice varieties.

The invention provides an Escherichia coli bi-component regulation and control system membrane protein ZraS mutant, a gene for coding the mutant, a recombinant vector, a preparation method and an application of the Escherichia coli bi-component regulation and control system membrane protein ZraS mutant. The mutant comprises one or more of S154T, A214S, Q313R and T415A, and the mutant comprises one or more of S154T, A214S, Q313R and T415A. The preparation method of the mutants comprises the following steps: constructing the SP-ZraS bacteriophage; alternately evolving the substrate specificity of the SP-ZraS bacteriophage on the lead ions through positive screening and negative screening by adopting a bacteriophage-assisted continuous directed evolution (PACE) method, so as to obtain an evolutionary sample; performing amino acid sequencing analysis on the evolutionary sample to obtain mutation site information; and constructing an expression vector of the membrane protein ZraS mutant according to mutation site information, recording the expression vector as pZraS, and performing expression to obtain the membrane protein ZraS mutant. The response sensitivity of the mutant to metal lead ions is remarkably improved compared with that of a wild type system, the regulation and control range to lead is enlarged, and the detection limit is as low as 1 mu M; meanwhile, when the ion concentration range is 0-10 mu M, the specific and sensitive detection on the heavy metal lead ions can be realized.

The invention discloses an improved protein mMet el for relieving tropomyosin sensitization response of prawns as well as a preparation method and application of the improved protein. The improved protein mMet el has an amino acid sequence shown as SEQ ID NO:1. The preparation method comprises the following steps: (1) contrasting metapenaeus tropomyosin mMet el antigen-specific epitope amino acid sequences and tropomyosin sequences of four marine fishes, performing amino acid sequence analysis, and redesigning antigen epitope amino acid residue sequences so as to obtain the amino acid sequence of the improved protein mMet el; (2) performing reverse transcription and translation so as to obtain cDNA; (3) treating and combining the obtained cDNA and vector plasmids through restriction enzymes so as to obtain a recombinant plasmid vector; (4) introducing the recombinant plasmid vector into host bacteria, and expressing the improved protein mMet el; (5) purifying, thereby obtaining a standard substance of the improved protein mMet el. The improved protein disclosed by the invention has the characteristics of high yield, stable production and low cost.

An object of the present invention is to provide a method for detecting predisposition for chronicity of hepatitis B and / or the pathological progress, including an allele associated with chronicity of hepatitis B and / or the pathological progress. The above-described object is achieved by providing a method that includes a process of identifying alleles which are susceptible and resistant to chronicity of hepatitis B and / or the pathological progress in which a difference between a chronic hepatitis B patient group and a healthy control group is accurately reflected and comparing the alleles with base sequences or amino acid sequences corresponding to the alleles in a specimen; a process of analyzing whether bases of sites corresponding to the alleles in the base sequences of the specimen match bases of the alleles; and a process of specifying whether the hepatitis B of the specimen becomes chronic and / or the pathology is progressed, a method of performing inspection using the method, a reagent used for the method, and a test kit including the reagent.

The invention discloses a red purple bud tea tree R2R3-MYB gene CsMYB2 and its application, belonging to the field of biological genes. The present invention obtains the nucleotide sequence of the CsMYB2 gene as shown in SED NO ID: 1 by designing the CsMYB2 fragment, the RACE fragment and full-length primers, amplifying and sequencing, and then translating it into an amino acid sequence and analyzing the structure of the gene. From the analysis of the amino acid structure of CsMYB2, CsMYB2 may have the function of regulating the biosynthesis of anthocyanins in tea tree buds and leaves, and then it was confirmed that CsMYB2 has the function of regulating anthocyanins biosynthesis by transforming Arabidopsis. It laid the foundation for the application of CsMYB2 in improving the accumulation of plant pigments.

The invention discloses an acipenser sinensis antibacterial peptide and a preparation method and an application thereof, and particularly discloses a novel acipenser sinensis natural antibacterial peptide pen-hepcidin, an amino acid sequence for encoding a gene and an application of a protein to preparation of a medicament for treating infectious diseases and a feed additive. An antibacterial peptide gene pen-hepcidin is cloned from acipenser sinensis blood with an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method, and the DNA (Deoxyribose Nucleic Acid) sequence of the antibacterial peptide gene pen-hepcidin is shown as a sequence SEQ ID:1 in a sequence table. The amino acid sequence of a protein (pen-hepcidin) encoded by using the gene is shown as SEQ ID:3 in a sequence table. According to amino acid sequence analysis, a protein polypeptide which is similar to the antibacterial peptide is not found in a protein database, and belongs to a novel antibacterial peptide. The antibacterial peptide disclosed by the invention has antibacterial activity on a part of Gram-positive bacteria and Gram-negative bacteria, has a remarkable effect on drug-resistant strains, and can be used for preparing a medicament for treating infectious diseases or applied as antibacterial feed additives and the like.

A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: TCAGACAGCCAGCTGTGCAG GAACAACCAT GGCCACTGCC GGAGGCTCTG CTTCCACATGGAGAGCTGGG CTGGGAGCTGCATGAACGGC CGCCTGCGCT GCTGCAGGTTCTCCACCAAG CAGCCCTTTT CCAACCCTAA ACATTCAGTG CTGCACACAGCAGAGCAGGA CCCTTCCCCA AGCCTTGGAG GGACGTGA. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (A) collecting broken mucosa cells of chicken intestinal tract; (B) breaking vesicles; (C) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (D) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol / L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm / h, and range 20mV); (E) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (F) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (G) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.