Supercharge Your Innovation With Domain-Expert AI Agents!

Genetic engineering immunosuppressive polypeptide and preparation method and application

An immunosuppressive and genetic engineering technology, applied in the fields of genetic engineering immunosuppressive polypeptides, preparation and use, can solve the problems of poor potassium channel selectivity, toxic and side effects, etc., and achieve the effects of strong specificity, high stability, and not easy to deteriorate.

Inactive Publication Date: 2009-05-06
WUHAN UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Poor selectivity of potassium channels with different roles and serious potential side effects have become the pathogenic shortcomings of small molecule drug development. This is mainly because the amino acid residue sequence of the Kv1.1-Kv1.7 target region of organic small molecule drug candidates is almost complete unanimous

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering immunosuppressive polypeptide and preparation method and application
  • Genetic engineering immunosuppressive polypeptide and preparation method and application
  • Genetic engineering immunosuppressive polypeptide and preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Molecular design of embodiment 1 LWX-1 and LWX-AD-1 polypeptide sequence

[0051] Through protein structure prediction ( http: / / swissmodel.expasy.org / / SWISS-MODEL.html ) SWISS-MODEL program and protein structure analysis ( http: / / swissmodel.expasy.org / spdbv / ) Swiss-Pdb Viewer program, based on our deep understanding of the diversity and mechanism of interactions between scorpion venom polypeptides and potassium channels (Biophysical Journal, 2004, 87: 105; J.Proteome.Res.2007, 6: 611; J .Chem.Inf.Model., 2007, 47 (5): 1967; Proteins-In press), molecular design specifically acts on the protein polypeptide sequence of potassium channel Kv1.3:

[0052] LWX-1: VGINVKC (1) KHSRQC (2) LKPC (3) KDAGMRFGKC (4) TNGKC (5) HC (6) TPK (SEQ ID NO: 1)

[0053] LWX-AD-1: NEAVPTGGC (1) PFSDFFC (2) AKRC (3) KDMKFGNTGRC (4) TGPNKTVC (5) KC (6) SI (SEQ ID NO: 2)

[0054] Both LWX-1 and LWX-AD-1 polypeptides have 3 pairs of disulfide bonds in the molecule, and their pairing methods ar...

Embodiment 2

[0055] Example 2 Expression, purification and analysis of LWX-1 and LWX-AD-1 polypeptide sequences

[0056] According to the LWX-1 and LWX-AD-1 polypeptide sequences, the nucleotide sequence encoding the protein was deduced by conventional methods, and on this basis, primers were designed for PCR amplification to obtain the target gene.

[0057] 4 primers for LWX-1 polypeptide:

[0058] Forward primers are:

[0059] Primer P1: 5'GTGAATTCGATGACGATGACAAGGTGGGTATTAATGTGAA3';

[0060] Primer P2: 5'GGTATTAATGTGAAATGTAAGCATAGCCGCCAATGTCTGAAA CCATGCAAGGATGCTG3';

[0061] The reverse primer is:

[0062] Primer P3: 5'GGTACAATGGCATTTGCCATTGGTGCATTTACCAAATCTCATT CCAGCATCCTTG3';

[0063] Primer P4: 5'TAGCTCGAGTCACGGGGTACAATGGCATTTGC3'.

[0064] 2 primers for LWX-AD-1 polypeptide:

[0065]Primer P1: 5'GATGGATCCGATGACGATGACAAGAATGAAGCGGTGCCAACA3'

[0066] Primer P2: 5'GCTCTCGAGTTAGATAGAACATTTACAAAC3'

[0067] For the LWX-1 polypeptide, two rounds of PCR amplification reactions were ...

Embodiment 3

[0081] Example 3 Analysis of the Pharmacological Activity of Recombinant LWX-1 and LWX-AD-1 Proteins on Potassium Channel Kv1.3 Targets

[0082] COS-7 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2, and the potassium channel Kv1.3 recombinant plasmid was treated with Sofast TM The transfection kit was used for transfection, and the transfected cells were selectively cultured on 0.8mg / ml Geneticin medium. The pharmacological activities of LWX-1 and LWX-AD-1 proteins were determined and analyzed using a whole-cell patch clamp instrument (EPC-10 dual-channel patch clamp amplifier HEKA, Elektronik, Lambrecht, Germany). The setting of experimental parameters, data collection and stimulation application are all controlled by Pulse software. The filter 1 of the instrument is set to 10kHz (Bessel), the filter 2 is set to 2.9kHz (Bessel), and the electrode impedance is 2-5MΩ. After forming a high-impedance (1-5GΩ) seal between the electrode and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering immunity inhibiting peptide, a preparation method and application thereof. The invention separates a protein taking amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 1 as the sequence. The primer related to the genetic engineering inserts the ribonucleotide sequence of LWX-1 and LWX-AD-1 into a expression vector pGEX-6P-1 to constitute a recombinant expression plasmid; the recombinant plasmid transfers BL21(DE3), and then the cell splitting is subjected to GST affinity chromatography, enterokinase cutting and chromatogram purification to obtain LWX-1 and LWX-AD-1, and the molecule is respectively 4073.1Da and 4615.03Da through mass spectrum identification. LWX-1 and LWX-AD-1 protein can be applied to preparing medicines for curing or preventing target kalium channel Kv1.3, RRMS and rheumatic arthritis. The method is simple and easy to implement, and is convenient to operate.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a sequence of immunosuppressive scorpion venom polypeptide LWX-1 and LWX-AD-1, and also relates to a genetic engineering preparation method of an immunosuppressive scorpion venom polypeptide, and also relates to a polypeptide identification potassium channel Kv1 .3 function and its use in the preparation of medicines for treating or preventing multiple sclerosis, type I diabetes, rheumatoid arthritis and other autoimmune diseases mediated by T cells. Background technique [0002] Autoimmune disease refers to a primary immune disease in which the body's own antibodies or sensitized lymphocytes destroy and damage its own tissues and cell components, resulting in tissue damage and organ dysfunction. About 5-8% of the world's population is threatened by more than 40 autoimmune diseases. At present, the commonly used methods to fight autoimmune diseases, one is to use steroids to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/44A61K38/17A61P19/02A61P37/06
CPCC07K14/435A61K38/00A61P19/00A61P19/02A61P37/06
Inventor 李文鑫吴英亮曹志贱韩松尹世金陈宗运
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More