Synthesis of (R)-styrene glycol by coupling acceleration of (R)-carbonyl reduction enzyme and formic dehydrogenase

A technology of phenylethylene glycol and hydroxyacetophenone, applied in the field of biocatalytic asymmetric transformation, can solve problems such as high price and unstable coenzyme

Active Publication Date: 2010-11-03
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Coenzymes are generally unstable, expensive, and cannot be replaced by general synthetic substances
In the asymmetric reduction reaction of biocatalysis, the inability to recycle the coenzyme is the "bottleneck" factor that limits its industrial application
Whole cells can provide a certain amount of coenzyme for the reaction through their own metabolism, but according to the chemical equivalent balance, when the substrate concentration increases and the amount of coenzyme required for the reaction increases, the supply of coenzyme becomes the main limiting factor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] The bacterial culture of Candida parapsilosis (C.parapsilosis) CCTCC M203011 and Candida boidinii (C.boidinii) consists of: glucose 4%, yeast extract 0.5%, (NH 4 ) 2 HPO 4 1.3%, KH 2 PO 4 0.7%, ZnSO 4 .7H 2 O 0.03%, NaCl 0.01%, pH 7.0.

[0072] The two kinds of yeast were inoculated into 250 mL shake flasks with 20% medium content and cultured at 30° C. and 150 rpm for 48 h with shaking.

Embodiment 2

[0074] Extraction of Candida parapsilosis (C.parapsilosis) and Candida boidinii (C.boidinii) genome: the thalline cultured in Example 1 was centrifuged at 6,000 rpm for 20 min, washed twice with physiological saline, and collected Genome was extracted from cells using Genomic DNA Extraction Miniprep System (VIOGENE Company), a genomic DNA extraction kit.

Embodiment 3

[0076] Codon-optimized primer design for the rcr gene:

[0077] Rcr-F1:5'-ATCG CATATG TCAATTCCATCAAGCCAGTACGGATTCGTATTCAATAAGCAATCAGGACTTAAGTTGCGT-3' (Nde I),

[0078] Rcr-F2:5'-GCATTGCGTGAAATTCGTATCTTG-3'

[0079] Rcr-R1:5'-CAAGATACGAATTTCACGCAATGC-3',

[0080] Rcr-R2:5'-TGACT CTCGAG CTATGGATTAAAAACAACACGACCTTCATAAGCATTGTTACGCAA-3' (Xho I). When designing mutation points, the CGA or AGA at the 61st-63rd, 829th-831st, 838th-840th, 970th-972th, 991st-993rd were all mutated into CGT.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention relates to promotion of synthesis of (R)-styrene glycol by coupling (R)-carbonyl reductase and formic dehydrogenase, which belongs to the technical field of asymmetrical transformation of biological catalysis. The invention provides a recombinant Escherichia coli, namely E.coli Rosetta / pETDuet-rcr-fdh, with a preservation number of CCTCC NO: M208123, wherein the (R)-special carbonyl reductasei and the formic dehydrogenase are coupled by a co-expression mode; asymmetrical transformation reaction is catalyzed by utilizing a cultured recombinant strain and taking 2-hydroxyacetophenone as a substrate; and the optical purity of the (R)-styrene glycol reaches 100 percent e.e., and the yield of the (R)-styrene glycol reaches 85.9 percent by optimizing the biotransformation reaction conditions. The invention utilizes double-enzyme coupling technology to solve the problem of limitation of regeneration cycle of coenzyme under the condition of high-concentration substrate, provides an effective path for high-efficiency and low-cost preparation of the (R)-styrene glycol, and lays a foundation for industrial application of the biosynthesized (R)-styrene glycol.

Description

technical field [0001] The invention relates to efficient preparation of (R)-phenylethylene glycol under high substrate concentration by using recombinant Escherichia coli co-expressed with (R)-carbonyl reductase gene and formate dehydrogenase gene, and belongs to the technical field of biocatalytic asymmetric transformation. Background technique [0002] Chiral compounds have been more and more widely used in the production of fine chemicals such as medicines, pesticides, hormones, and food additives. For example, optically pure phenylglycol is not only an indispensable and important chiral additive in liquid crystal materials, but also It is an important intermediate for the preparation of optically active medicines, pesticides and functional materials. [0003] Asymmetric reduction reactions catalyzed by oxidoreductases are often used in the preparation of chiral compounds. This type of reaction requires coenzymes as hydrogen or electron transmitters. Commonly used coenzy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/53C12N15/70C12P7/22C12R1/19
Inventor张荣珍徐岩孙莹
OwnerJIANGNAN UNIV