Synthesis of (R)-styrene glycol by coupling acceleration of (R)-carbonyl reduction enzyme and formic dehydrogenase
A technology of phenylethylene glycol and hydroxyacetophenone, applied in the field of biocatalytic asymmetric transformation, can solve problems such as high price and unstable coenzyme
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0071] The bacterial culture of Candida parapsilosis (C.parapsilosis) CCTCC M203011 and Candida boidinii (C.boidinii) consists of: glucose 4%, yeast extract 0.5%, (NH 4 ) 2 HPO 4 1.3%, KH 2 PO 4 0.7%, ZnSO 4 .7H 2 O 0.03%, NaCl 0.01%, pH 7.0.
[0072] The two kinds of yeast were inoculated into 250 mL shake flasks with 20% medium content and cultured at 30° C. and 150 rpm for 48 h with shaking.
Embodiment 2
[0074] Extraction of Candida parapsilosis (C.parapsilosis) and Candida boidinii (C.boidinii) genome: the thalline cultured in Example 1 was centrifuged at 6,000 rpm for 20 min, washed twice with physiological saline, and collected Genome was extracted from cells using Genomic DNA Extraction Miniprep System (VIOGENE Company), a genomic DNA extraction kit.
Embodiment 3
[0076] Codon-optimized primer design for the rcr gene:
[0077] Rcr-F1:5'-ATCG CATATG TCAATTCCATCAAGCCAGTACGGATTCGTATTCAATAAGCAATCAGGACTTAAGTTGCGT-3' (Nde I),
[0078] Rcr-F2:5'-GCATTGCGTGAAATTCGTATCTTG-3'
[0079] Rcr-R1:5'-CAAGATACGAATTTCACGCAATGC-3',
[0080] Rcr-R2:5'-TGACT CTCGAG CTATGGATTAAAAACAACACGACCTTCATAAGCATTGTTACGCAA-3' (Xho I). When designing mutation points, the CGA or AGA at the 61st-63rd, 829th-831st, 838th-840th, 970th-972th, 991st-993rd were all mutated into CGT.
PUM
| Property | Measurement | Unit |
|---|---|---|
| optical purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More