Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof

An auxotrophic, Saccharomyces cerevisiae technology, applied in the field of diploid histidine auxotrophic Saccharomyces cerevisiae and its construction, can solve problems such as characteristic change, achieve simple construction method, easy identification and protection, and maintain original characteristics constant effect

Inactive Publication Date: 2011-01-26
TSINGHUA UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Existing methods for carrying out genetic engineering or genetic modification of Saccharomyces cerevisiae all use haploid strains as initial strains, but most of the yeast strains used in industrial production are diploid or polyploid. Transformation after haploidization will lead to changes in certain characteristics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof
  • Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof
  • Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Construction of Homologous Recombination Fragment His3L-Kan-His3R

[0053] 1.1 Construction of pUC19-His3L-Kan plasmid containing homologous recombination left arm and g418 resistance gene

[0054] 1.1.1 Amplify the His3L-Kan fragment (926bp) containing homologous recombination left arm and g418 resistance

[0055] According to the sequence data of S.cerevisiae His3 gene reported in Genebank (Accession No. NC001147) and the sequence data of pPIC9K plasmid (Invitrogen, Cat. No. V175-20), PCR primers were designed using Primer Premier 5 software.

[0056] Upstream primer His3L-1F-Kan

[0057] 5'-GATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGATGAGCCATATTCAACGGG-

[0058] 3' (SEQ ID No.1)

[0059] Upstream primer His3L-2F

[0060] 5'-GGAATTCATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTCAAATGAAACCAAGATTCA

[0061] GATTGCGATCTCTTTAAAG-3' (SEQ ID No. 2)

[0062] Downstream primer Kan-R

[0063] 5'-ACGCGTCGACTTAGAAAAACTCATCGAGCATC-3' (SEQ ID No.3)

[0064] 1) Use the pPIC9K pla...

Embodiment 2

[0156] Example 2 Obtaining of single chromosome exchange Saccharomyces cerevisiae strain

[0157] The 1135bp His3L-Kan-His3R fragment obtained in 1.3 of Example 1 was used to transform S. cerevisiae TSH-Sc-001 (CGMCC NO.1949) competent cells by electroporation. The electroporator used was Gene Pulser Xcell TM Electroporation System (Bio-Rad Company), the preparation method of S.cerevisiae competent cells refers to the instrument manual.

[0158] For each electroporated sample, prepare a small test tube containing 1ml of 1M sorbitol YPD liquid medium and place it on ice to cool, and prepare a 2mm electroporation cup and place it on ice to cool.

[0159] Cool the His3L-Kan-His3R fragment (100ng / 5μl) to be transformed on ice, add 40μl of competent cells to the DNA sample, mix gently, and place on ice for about 5 minutes.

[0160] The electroporator was prepared, and the Saccharomyces cerevisiae cells were transformed according to the preset program. The parameters of the elect...

Embodiment 3

[0181] Example 3 Chromosome exchange Saccharomyces cerevisiae strain

[0182] TSH-Sc-001 (His3) obtained with embodiment 2 + / - ) strain to prepare competent cells, the transformation method is the same as in Example 2. The transformed cells were spread on YPD plate medium containing 1M sorbitol and 0.5g / L g418, and cultured upside down at 30°C for 3 days. The culture method of monoclonal colony, genomic DNA extraction method and PCR identification method are the same as embodiment 2.

[0183] The results of agarose gel electrophoresis of PCR products showed (see Figure 6 ), the monoclonal colony that can grow on the YPD medium containing 0.5g / L g418 obtained through twice electrotransformation, only primer His3-F and Kan-ID can amplify the PCR product (SEQ ID No. 14), primers His3-F and His-ID failed to amplify the PCR product, which proved that homologous recombination had occurred in both chromosomes, and obtained Saccharomyces cerevisiae (S.cerevisiae) TSH-Sc-001 (His3-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses amphiploid histidine auxotroph saccharomyces cerevisiae and a constructing method thereof, belonging to the field of microorganism biological engineering. The saccharomyces cerevisiae is made from an amphiploid saccharomyces cerevisiae bacterial strain which is TSH-Sc-001(His3- / -) and contains a histidine auxotrophic mark and a g418 resistance mark. The constructing methodof the amphiploid histidine auxotroph saccharomyces cerevisiae comprises the following steps: the amphiploid saccharomyces cerevisiae bacterial strain is adopted as a start bacterial strain, the start bacterial strain is transformed twice by a segment with target genes, and the amphiploid histidine auxotroph saccharomyces cerevisiae bacterial strain with two chromosomes being subjected to homologous recombination is obtained by two-time homologous recombination. The saccharomyces cerevisiae is easily identified and protected; in addition, the constructing method of the amphiploid histidine auxotroph saccharomyces cerevisiae provides a novel way and a method for the reconstruction of gene engineering of amphiploid or multiploid saccharomyces, is simple and highly efficient, and keeps the primary characteristic of the saccharomyces unchanged.

Description

technical field [0001] The invention belongs to the field of microbial bioengineering, and in particular relates to a diploid histidine auxotrophic Saccharomyces cerevisiae and a construction method thereof. Background technique [0002] Saccharomyces cerevisiae Hansen is a traditional alcohol production strain with good industrial production characteristics, fast sugar consumption, high ethanol tolerance, and strong resistance to toxic substances in hydrolyzed sugar solution; its full sequence has been determined, genetic manipulation The technology has also matured. [0003] Auxotrophic yeast strains play an important role in the field of genetic engineering and genetic modification, among which histidine auxotrophy is one of the most commonly used auxotrophs; in addition, geneticin (g418) resistance gene is also commonly used for yeast screening mark. [0004] A diploid Saccharomyces cerevisiae TSH-Sc-001 (preservation number is CGMCC NO.1949) used for solid-state ferme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/19C12N15/09C12R1/865
Inventor李十中郑焕娣
OwnerTSINGHUA UNIV