Specificity promoter for flowers of plants and screening marker-free conversion vector thereof
A promoter-specific technology, applied in angiosperms/flowering plants, plant products, plant genetic improvement, etc., can solve the problem of low efficiency in removing marker genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1. Isolation and functional identification of rice flower-specific promoter Os45
[0050] 1 Cloning of rice flower-specific promoter Os45
[0051] a) Expression analysis of some genes related to flowering in rice
[0052] In order to clone the rice flower-specific promoter, the expression analysis of 9 transcription factors related to rice flowering was carried out by RT-PCR. The results of agarose gel electrophoresis of PCR amplification products were as follows: figure 2 . The results of RT-PCR analysis showed that S556 (OsNAC9) and S561 (OsMADs45) genes were specifically expressed in rice flowers, while the other seven genes did not show flower-specific expression characteristics.
[0053] Therefore, the OsNAC9 and OsMADs45 genes were further analyzed. The calli, roots, stems, leaves and floral organs of different development stages (flowering stage, 7 days after flowering) of rice (Nipponbare) were collected for RT-PCR analysis. Methods as below:
[0...
Embodiment 2
[0069] Example 2, Construction of Cre / loxP System Recombinant Expression Vector Containing Os45 Promoter
[0070] 1. Construction of the Cre / loxP system vector pOs45:MF under the control of Os45
[0071] a) Design and synthesis of loxP sequence
[0072] According to the sequence of loxP (Guo et al., 1999), design a 108bp double-stranded DNA:
[0073] 5' CTCGAG GCCTAATAACTTCGTATAGCATACATTATACGAAGTTAT GAATTC TT AAGCTT CATAACTTCGTATAGCATACATTATACGAAGTTATGGGCGCG CCCGGG A3', this sequence was synthesized by Shanghai Boya Company and cloned into the pMD18-T vector (purchased from Beijing Leibofeier Biotechnology Co., Ltd.) to obtain the vector pMD18-T-loxP. This fragment contains two loxP sites in the same direction (shown in italics in the sequence), EcoRI and HindIII recognition sites (shown underlined) are included between the two sites, and there are XhoI and SamI recognition sites at both ends of the sequence point (underlined).
[0074] b) Construction of Cre / loxP s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 