Unlock instant, AI-driven research and patent intelligence for your innovation.

Specificity promoter for flowers of plants and screening marker-free conversion vector thereof

A promoter-specific technology, applied in angiosperms/flowering plants, plant products, plant genetic improvement, etc., can solve the problem of low efficiency in removing marker genes

Inactive Publication Date: 2009-09-16
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some inducible promoters are mainly used to control the expression of the Cre recombinase gene at a specific time (Sugita et al., 2000; Zuo et al., 2001), such as the tobacco anther tapetum-specific promoter TA29 to control the expression of Cre to Obtain marker-free transgenic plants, but it is not efficient in removing marker genes in monocots

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specificity promoter for flowers of plants and screening marker-free conversion vector thereof
  • Specificity promoter for flowers of plants and screening marker-free conversion vector thereof
  • Specificity promoter for flowers of plants and screening marker-free conversion vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Isolation and functional identification of rice flower-specific promoter Os45

[0050] 1 Cloning of rice flower-specific promoter Os45

[0051] a) Expression analysis of some genes related to flowering in rice

[0052] In order to clone the rice flower-specific promoter, the expression analysis of 9 transcription factors related to rice flowering was carried out by RT-PCR. The results of agarose gel electrophoresis of PCR amplification products were as follows: figure 2 . The results of RT-PCR analysis showed that S556 (OsNAC9) and S561 (OsMADs45) genes were specifically expressed in rice flowers, while the other seven genes did not show flower-specific expression characteristics.

[0053] Therefore, the OsNAC9 and OsMADs45 genes were further analyzed. The calli, roots, stems, leaves and floral organs of different development stages (flowering stage, 7 days after flowering) of rice (Nipponbare) were collected for RT-PCR analysis. Methods as below:

[0...

Embodiment 2

[0069] Example 2, Construction of Cre / loxP System Recombinant Expression Vector Containing Os45 Promoter

[0070] 1. Construction of the Cre / loxP system vector pOs45:MF under the control of Os45

[0071] a) Design and synthesis of loxP sequence

[0072] According to the sequence of loxP (Guo et al., 1999), design a 108bp double-stranded DNA:

[0073] 5' CTCGAG GCCTAATAACTTCGTATAGCATACATTATACGAAGTTAT GAATTC TT AAGCTT CATAACTTCGTATAGCATACATTATACGAAGTTATGGGCGCG CCCGGG A3', this sequence was synthesized by Shanghai Boya Company and cloned into the pMD18-T vector (purchased from Beijing Leibofeier Biotechnology Co., Ltd.) to obtain the vector pMD18-T-loxP. This fragment contains two loxP sites in the same direction (shown in italics in the sequence), EcoRI and HindIII recognition sites (shown underlined) are included between the two sites, and there are XhoI and SamI recognition sites at both ends of the sequence point (underlined).

[0074] b) Construction of Cre / loxP s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specificity promoter for flowers of plants and a screening marker-free conversion vector thereof. The promoter is a DNA molecule of (a) or (b) or (c) as follows: (a) DNA molecule formed by deoxyribonucleotide shown in sequence 1 in a sequence list; (b) DNA molecule hybridized with DNA sequence limited by (a) in strict conditions; or (c) DNA molecule which has more than 90 percent of homology with the DNA sequence limited by (a) and can control the specific expression of a target gene in the floral organs of plants. The invention also discloses a recombinant expression vector containing the promoter. The recombinant expression vector is a plant expression vector of a recombinant Cre / loxP system containing the promoter, can be applied to culturing marker-free transgenic plants and can effectively remove marker genes in monocotyledons.

Description

technical field [0001] The invention relates to a plant flower-specific promoter and a transformation vector without screening markers. Background technique [0002] Promoter is the most important factor among gene expression regulators, which basically determines whether, when and where a gene is expressed. According to the mode of action and function, promoters can be roughly divided into three categories: constitutive promoters, specific promoters and inducible promoters. The characteristic of an inducible promoter is that the gene controlled by this type of promoter is not expressed or has very low expression in the absence of an inducing factor, but once induced by an inducing factor, the expression of the gene increases rapidly and substantially. For example: hormone-inducible promoters, chemical-inducible promoters, light-inducible promoters, etc. The characteristics of constitutive promoters are that the expression of structural genes controlled by them is continuo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82A01H1/00A01H5/00
Inventor 储成才白先权
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI