Check patentability & draft patents in minutes with Patsnap Eureka AI!

Reg III/proinsulin double-gene plasmid as well as building method and application thereof

A proinsulin, dual gene technology, applied in the fields of genetic engineering and gene therapy, can solve problems such as difficulties, and achieve the effects of inhibiting proliferation, improving symptoms of hyperglycemia, and restoring balance

Inactive Publication Date: 2010-07-07
HUAZHONG UNIV OF SCI & TECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, studies have shown that the method of treating only by blocking a single link in the onset of type 1 diabetes has certain limitations in its effect. It is difficult to achieve the purpose of safe and effective treatment of type 1 diabetes with a single drug, and based on the genetic Due to the heterogeneity of disease and pathology, it is extremely difficult to find a safe and effective treatment method for all patients, so the combination of treatment methods has become a reasonable idea to improve the treatment of type 1 diabetes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reg III/proinsulin double-gene plasmid as well as building method and application thereof
  • Reg III/proinsulin double-gene plasmid as well as building method and application thereof
  • Reg III/proinsulin double-gene plasmid as well as building method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Construction and Identification of RegIII / Proinsulin Double Gene Eukaryotic Co-expression Plasmid

[0051] The pCMV6-Kan / Neo plasmid vector (product of Beijing Origene Co., Ltd.) containing the RegIII gene was double-digested with restriction endonucleases Kpn I and XhoI to obtain the RegIII gene fragment, and double-digested with restriction endonucleases Kpn I and XhoI pBudCE4.1 empty plasmid vector (product of Invitrogen, USA), and T4 DNA ligase was used to connect the RegIII gene fragment and pBudCE4.1 plasmid vector at a molar ratio of 5:1 to construct a single-gene plasmid containing the RegIII gene.

[0052] Take the pancreas of the mouse, extract the total mRNA with Trizol reagent, reverse transcribe it into cDNA, use it as a template, and use the upstream and downstream primers of the proinsulin gene (upstream primers: 5′-3′: CATA CTGCAG GCCTATCTTCCAGGTTATTGTTTC (the underlined part is the Pst I restriction site; downstream primer: 5′-3′: CGTC GGATCC CTAGTTGC...

Embodiment 2

[0055] Establishment of type 1 diabetes mouse model and gene therapy method

[0056] Select male SPF Balb / c mice with a body weight of 16-20g and 6-8 weeks of age, and use a small dose of STZ (40mg / Kg) to establish a type 1 diabetic mouse model by intraperitoneal injection for 5 consecutive days. Blood glucose greater than 16.7mmol / L is the criterion for successful establishment of the model.

[0057] After the successful establishment of the type 1 diabetic mouse model, the diabetic mice were randomly divided into a model group, a pBudCE4.1 empty vector control group (pBudCE4.1) and a RegIII / proinsulin dual gene plasmid group (RegIII-proinsulin -pBudCE4.1), 10 mice in each group; another 10 unmodeled Balb / c mice were used as the normal control group.

[0058] On the day of grouping, mice in RegIII / proinsulin double gene group were given intramuscular injection of RegIII / proinsulin double gene eukaryotic co-expression plasmid 100 μg / mouse in the left hind limb; pBudCE4.1 empt...

Embodiment 3

[0060] Effect of RegIII / proinsulin double-gene co-expression plasmid on blood glucose in type 1 diabetic mice

[0061] After successful modeling, the blood glucose of mice in each group was measured the next day, using a JPS-III blood glucose measuring instrument produced by Beijing Yicheng Bioelectronic Technology Co., Ltd. for measurement. The results are shown in Table 1. After 4 weeks of treatment, the blood glucose of pBudCE4.1 empty plasmid control group and model group mice were significantly higher than 16.7mmol / L, and increased with time; After 1 week of nuclear co-expression plasmid treatment, the hyperglycemia symptoms of diabetic mice were significantly improved (P<0.01), and the blood glucose of mice continued to decrease and gradually stabilized after 3 consecutive administrations. It shows that the RegIII / proinsulin double-gene eukaryotic co-expression plasmid can significantly improve the hyperglycemia symptoms of type 1 diabetic mice.

[0062] Table 1 Effects...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a plasmid for treating 1 type diabetes, which is a double-gene eukaryon co-expression plasmid built by a gene recombination method and containing a pancreas islet beta cell regeneration (Reg) III gene and a proinsulin gene, wherein the Reg III gene and the proinsulin gene can be respectively expressed under the induction of an EF-1alpha promoter and a cytomegalovirus (CMV) promoter of a pBudCE4.1 plasmid vector. The Reg III / proinsulin double-gene eukaryon co-expression plasmid can play a hypoglycemic role by recovering the autoimmunity tolerance state of in the body of a 1 type diabetes patient and promoting the regeneration of beta cells.

Description

technical field [0001] The present invention relates to the fields of genetic engineering and gene therapy, in particular to directly introducing a double-gene eukaryotic co-expression plasmid containing RegIII gene and proinsulin gene into type 1 diabetic mice to express proinsulin and RegIII protein and restore the body's autoimmunity Tolerance state and promote the regeneration of pancreatic β cells, so as to achieve the purpose of comprehensive prevention and treatment of type 1 diabetes gene therapy. Background technique [0002] Type 1 diabetes mellitus (T1DM), also known as insulin-dependent diabetes mellitus, is an autoimmune disease mediated by T lymphocytes and characterized by progressive damage to pancreatic β cells and absolute insulin secretion. The genetic background of susceptibility and autoimmune resistance Deletion is the main cause of its pathogenesis. [0003] In the pathogenesis of type 1 diabetes, T lymphocytes, especially helper T lymphocytes (Th), p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79C12N15/10A61K48/00A61P3/00
Inventor 向明侯文睿
Owner HUAZHONG UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More