Primers and application thereof in quick detection of nosema bombycis
A technology of microsporidia and silkworm, which is applied in the application field of rapid detection, and achieves the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] In this example, the CTAB method and the boiling precipitation method were used to prepare the DNA of N. silkworm for detection by the LAMP method.
[0035] In this embodiment, Microsporidia silkworm ( Nosema bombycis , N. bombycis , referred to as N.b) (obtained by the Sericulture Biotechnology Laboratory of South China Agricultural University through conventional subculture with mulberry leaves, or No. silkworm provided by other laboratories or research institutes in this field) as materials, respectively passed CTAB method, boiling precipitation method (Liu Jiping. Identification technology and molecular phylogeny of insect microsporidia. South China Agricultural University, doctoral dissertation, 2005; Chen Dongmei, Lin Ying, Wang Yanxia. A simple method for isolating high-quality silkworm genomic DNA Sericulture Communication, 2007,27(2):5-9) Two methods were used to prepare N.b DNA template.
[0036] 1. The CTAB method was used to extract template DNA infected ...
Embodiment 2
[0041] Adopt respectively the Bombyx mori microsporidia that embodiment 1 boiling precipitation method and CTAB method obtain N. bombycis The template DNA was used for LAMP detection.
[0042] According to the N.b rRNA pseudopseudogene sequence published by Genbank (accession number D14632), the online software: Primer ExplorerV3 (http: / / primerexplorer.jp / elamp3.0.0 / index.html) was used to successfully design LAMP primers. The nucleotides of the primers The acid sequences (5'-3') are:
[0043] F2 GGTTTTTCTTGAAACTAGTTCTGT B2 GGTGAATTTTTTAACTACTTTGATGG FI2 TTCCAGCGTCGTTGATTCGC-CATGAATGAGTTGATGCAGTA BI2 CGAATACACTTACCGTCTAGGTCA-ATCATGTTGCTTCTTCATCG
[0044] LAMP reaction uses 25 μL system: 2.5 μL 10×Thermopol Buffer (20 mM Tris-HCl, pH8.8; 10 mM KCl; 2 mM MgSO 4 ; 20 mM (NH 4 ) 2 SO 4 ; 0.1% Triton X-100; ); 2.8 mM dNTPs; 1 M Betaine; 6 μL 25 mMMgCl 2 ; 40 pmol FI2 / BI2 (forward inner primer / reverse inner primer), 5 pmol F2 / B2 (forward out...
Embodiment 3
[0047] (1) Extracting No. spp. infected silkworm N. bombycis template DNA;
[0048] Biological material: Microsporidium silkworm ( Nosema bombycis , referred to as N.b), was subcultured by artificial mulberry leaves by the Sericulture Biotechnology Laboratory of South China Agricultural University (according to conventional methods, it will be coated on the back of fresh mulberry leaves and fed to silkworms, which is a routine experimental method for silkworm infection; it can also be used Silkworm Microsporidia provided by other laboratories or research institutes in this field); CTAB (cetyltrimethylammonium bromide), EDTA (disodium ethylenediaminetetraacetic acid), 6×Loading Buffer, Triton X- 100. Isopropanol (analytical grade), NaOH, KCl, Na 2 HPO 4 12H 2O, HCl (analytical pure), glycerol, etc. were purchased from Beijing Dingguo Biotechnology Co., Ltd.; chloroform and absolute ethanol were all analytically pure, purchased from the school equipment center, and DL2000 s...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap