Modulation of inflammatory responses by factor xi

A technology for factors and inflammatory diseases, applied in the field of regulation of inflammatory responses by factor XI, can solve problems such as harmful side effects

Inactive Publication Date: 2012-05-16
IONIS PHARMA INC
View PDF24 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of these drugs can have harmful side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modulation of inflammatory responses by factor xi
  • Modulation of inflammatory responses by factor xi
  • Modulation of inflammatory responses by factor xi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0123] In certain embodiments, methods, compounds and compositions are provided for administering a compound to an animal to modulate an inflammatory response, wherein the compound comprises a modulator of Factor XI. Modulation of Factor XI can result in an increase or decrease in Factor XI mRNA and protein expression to increase or decrease a desired inflammatory response. In certain embodiments, inhibition of Factor XI in an animal can be reversed by administering a modulator that targets Factor XI. In certain embodiments of the invention, Factor XI is inhibited by a modulator. Factor XI modulators may be modified oligonucleotides targeted to Factor XI.

[0124] In certain embodiments, provided are methods, compounds and compositions for treating, preventing or ameliorating Factor XI-associated inflammatory diseases, disorders and conditions in an animal in need thereof. In one embodiment, a method of ameliorating an inflammatory disease in an animal comprises administerin...

Embodiment 1

[0425] Example 1: Antisense Inhibition of Human Factor XI in HepG2 Cells

[0426]The effect of antisense oligonucleotides targeting Factor XI nucleic acids on Factor XI mRNA in vitro was tested. Cultured HepG2 cells at a density of 10,000 cells per well were transfected with liposome reagents containing 75 nM antisense oligonucleotides. After approximately 24 hours of treatment, RNA was isolated from the cells and levels of Factor XI mRNA were determined by quantitative real-time PCR. Factor XI mRNA levels according to RIBOGREEN The measured total RNA content was adjusted. Results are expressed as percent inhibition of Factor XI compared to untreated control cells.

[0427] The chimeric antisense oligonucleotides in Tables 1 and 2 were designed as 5-10-5 MOE gapmers. The gapmer is 20 nucleotides long, and the middle spacer contains 10 2'-deoxynucleotides and is connected to flanking regions containing 5 nucleotides on both sides (in the 5' and 3' directions). Every nucle...

Embodiment 2

[0438] Example 2: Dose-dependent antisense inhibition of human factor XI in HepG2 cells

[0439] Twelve gapmers were tested at different doses in HepG2 cells, and the inhibitory effects of these gapmers on human factor XI in vitro were all 84% or above. Cells were plated at a concentration of 10,000 cells per well and transfected with liposome reagents containing the antisense oligonucleotides shown in Table 3 at concentrations of 9.375 nM, 18.75 nM, 37.5 nM, 75 nM and 150 nM. After approximately 16 hours of treatment, RNA was isolated from the cells and the level of Factor XI mRNA was determined by quantitative real-time PCR. Human factor XI primer probe set RTS 2966 (forward sequence: CAGCCTGGAGCATCGTAACA, incorporated into the present invention as SEQ ID NO: 3; reverse sequence: TTTATCGAGCTTCGTTATTCTGGTT, incorporated into the present invention as SEQ ID NO: 4; probe sequence: TTGTCTACTGAAGCACACCCAAACAGGGAX, wherein X is a fluorophore, incorporated into the present inventi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed herein are antisense compounds and methods for modulating Factor XI and modulating an inflammatory disease, disorder or condition in an individual in need thereof. Inflammatory diseases in an individual such as arthritis and colitis can be ameliorated or prevented with the administration of antisense compounds targeted to Factor XI.

Description

[0001] sequence listing [0002] This application is filed together with a Sequence Listing in electronic form. The sequence listing is submitted as a file named BIOL0109WOSEQ.TXT, which was created on April 14, 2010, and is 84Kb in size. The information in the electronic form of the Sequence Listing is incorporated by reference into this application in its entirety. technical field [0003] The present invention provides methods, compounds and compositions for modulating inflammatory responses by administering to an animal a modulator of Factor XI. Background technique [0004] Factor XI [0005] Factor XI is synthesized in the liver and is a member of the "intrinsic pathway" of the coagulation cascade, which ultimately activates thrombin to prevent blood loss. This intrinsic pathway is triggered by the activation of Factor XII to XIIa. Factor XIIa converts Factor XI to Factor XIa, and Factor XIa converts Factor IX to Factor IXa. Factor IXa binds to its cofactor VIIIa,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00
CPCA61K31/7115C12N2310/341C12N2310/3341C12N2310/11C12N2310/346A61K31/7125C12N2310/315A61K31/712C12Y304/21027C12N15/113C12N2310/321A61P1/00A61P1/04A61P11/06A61P19/02A61P19/06A61P29/00A61P3/00A61P31/10A61P35/00A61P3/06A61P37/00A61P37/06A61P37/08A61P3/10C12N2310/3521
InventorB·P·莫尼亚J·R·克罗斯比R·A·马克雷德S·M·弗赖尔
OwnerIONIS PHARMA INC