Unlock instant, AI-driven research and patent intelligence for your innovation.

Duplex PCR diagnostic kit for detection of contagious caprine pleuropneumonia pathogen and preparation and use methods thereof

A diagnostic kit and technology for pleuropneumonia, applied in biochemical equipment and methods, methods based on microorganisms, measurement/inspection of microorganisms, etc., can solve the problems of not being able to be used as a diagnostic method for pathogens, high diagnostic costs, and long time consumption, and achieve Facilitate the deterministic diagnosis of pathogens, reduce tediousness and blindness, and have good convenience

Inactive Publication Date: 2012-08-15
GUIZHOU UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the three diagnostic methods, the traditional separation and identification of mycoplasma has high requirements on growth conditions and slow growth rate, so the diagnosis cost is high, difficult and time-consuming, and cannot immediately solve the problem of rapid diagnosis; serological tests are mainly indirect hemagglutination Test, complement fixation test and competitive ELISA, the three have poor sensitivity or specificity, and can not be used as a pathogenic diagnosis method; molecular biology technology has the advantages of fast, accurate, sensitive, specific, etc., especially the multiplex PCR method can be used for different pathogens at the same time diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Duplex PCR diagnostic kit for detection of contagious caprine pleuropneumonia pathogen and preparation and use methods thereof
  • Duplex PCR diagnostic kit for detection of contagious caprine pleuropneumonia pathogen and preparation and use methods thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] Embodiment of the present invention: goat infectious pleuropneumonia pathogen detection double PCR diagnostic kit raw material formula is:

[0028] 1000~2000μL PCR reaction solution, 100~200μL Taq DNA polymerase, 50~100μL positive control, 50~100μL negative control, 1mL-2 mL ultrapure water.

[0029] The PCR reaction liquid includes primer 1 mixed liquid, primer 2 mixed liquid, PCR reaction buffer and dNTP, and the volume ratio of the four liquids in the PCR reaction liquid is 2:2:5:1.

[0030] The primer 1 is the general primer Ps and Pa for Mycoplasma mycoides cluster 16S rRNA gene, the primer concentration is 10 μmol / L, and the primer sequence is shown in Table 1.

[0031] Table 1 Primer 1 (Ps and Pa) sequences

[0032] Primer Sequence (5'—3') PS GGGAGGCAGCAGTAGGGAAT Pa CAGCGTCAATAACAAGCCAGTAAG

[0033] The primer 2 is specific primers Ms and Ma for Mycoplasma ovipneumoniae 16S rRNA gene, the primer concentration is 10 μmol / L, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a raw material composition of a duplex PCR (polymerase chain reaction) diagnostic kit for detection of contagious caprine pleuropneumonia pathogen and a preparation method and a use method of the kit. The raw material composition comprises 1000-2000muL of PCR reaction liquid, 100-200muL of TaqDNA polymerase, 50-100muL of positive control, 50-100muL of negative control and 1-2mL of ultrapure water. The PCR reaction solution comprises a primer 1 mixture solution, a primer 2 mixture solution, a PCR reaction buffer and dNTPs (deoxyribonucleotide triphosphates), wherein the volume ratio of the four liquids in the PCR reaction solution is 2:2:5:1. The preparation method comprises the steps of determination of an optimum reaction annealing temperature, specific detection, sensibility test, clinical application detection and kit packaging. An effective method for rapid deterministic diagnosis of suspected goat pathogen and suspected cases of contagious caprine pleuropneumonia in goat farms is provided by the invention, providing technical support for the prevention and control of contagious caprine pleuropneumonia.

Description

technical field [0001] The invention relates to a goat infectious pleuropneumonia pathogen detection double PCR diagnostic kit and a preparation method. Background technique [0002] Contagious Caprine Plneuropneumonia (CCPP), also known as rotten lung disease, is a highly contagious infectious disease of goats. The Ministry of Agriculture of my country lists it as a second-class infectious disease. It clinically presents with fibrous pneumonia and pleurisy. The mortality rate is higher. Mycoplasma mycoides cluster members Mycoplasma capricolum subsp. capripneumoniae (Mccp), Mycoplasma mycoides subsp. mycoides LC (Mmm LC) and Mycoplasma mycoides subsp. Mycoplasma mycoides subsp.capri (Mmc) can cause goats to suffer from CCPP, and Mycoplasma ovipneumoniae (Mo) can also infect goats. [0003] At present, the diagnosis of CCPP at home and abroad mainly relies on pathogen isolation and identification, serological tests and molecular biology techniques. Compared with the three ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12R1/35
Inventor 周碧君张双翔程振涛文明王开功
Owner GUIZHOU UNIV