Isolation and identification of Yunnan tomato leaf curl viral genome and agrobacterium tumefaciens-mediated infective clone construction

An Agrobacterium-mediated, tomato koji technology, applied in genetic engineering, plant genetic improvement, microbial assay/inspection, etc., can solve problems such as affecting the efficiency of gemini virus inoculation, reducing experimental efficiency, and tedious operation steps. Large-scale promotion, easy operation, good repeatability

Inactive Publication Date: 2012-10-03
ZHEJIANG UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the Agrobacterium injection method needs to use the inoculation buffer to post-process the bacterial solution, and the operation steps are cumbersome, which reduces the experimental efficiency, and the injection inoculation method is poor in operability for plants with thick stems, which affects the inoculation efficiency of geminiviruses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isolation and identification of Yunnan tomato leaf curl viral genome and agrobacterium tumefaciens-mediated infective clone construction
  • Isolation and identification of Yunnan tomato leaf curl viral genome and agrobacterium tumefaciens-mediated infective clone construction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cloning and determination of Yunnan tomato leaf curl virus Y194 genome DNA

[0040] 1) Extraction of total plant DNA

[0041] Weigh 0.5-1.0 g of Yunnan tomato leaf curl virus-infected leaves in the field, add liquid nitrogen and grind to powder, quickly transfer the ground powder into 50 ml and add 4-8 ml of CTAB extract [containing 2% (v / v) 2-Mercaptoethanol (2-Me)] in a centrifuge tube. Heat in a water bath at 65°C, mix by inverting every 20-30 minutes, add an equal volume of 24:1 chloroform / isoamyl alcohol after 1 hour, mix by inverting up and down, and centrifuge at 10,000 rpm at 4°C for 5 minutes. Transfer the supernatant to another new 50 ml centrifuge tube, add 1 / 10 of the supernatant volume CTAB / NaCl and an equal volume of 24:1 chloroform / isoamyl alcohol, mix well, and centrifuge at 10,000 rpm at 4°C 5 min. Transfer the supernatant to another new 50 ml centrifuge tube, add 1 / 10 supernatant volume of 3 M NaAc (pH 5.2) and an equal volume of -20°C ...

Embodiment 2

[0044] Example 2 Construction of Infectious Clone of Yunnan Tomato Leaf Curl Virus Y194

[0045] Agrobacterium-mediated invasive cloning of geminivirus requires a full-length genome with more than 1.3-2.0 repeats and must include 2 intergenic regions (IR regions). Using viral genomic DNA as a template to contain Eco Y194EF (5'- GCGGAATTCCTTAAAGTGCTTTAG -3') and Y194ER (5'- TAGGAATTCATGGGAGCCCAAAG -3') at the R I single restriction site were used as primers, amplified by PCR and cloned into pGEM-T Vector to obtain pGEM-T-Y194, using Bam H I and Eco R I digested pGEM-T-Y194 to obtain 0.4 full-length DNA for insertion Bam H I and Eco The binary vector pBinPLUS obtained by R I double enzyme digestion was pBinPLUS-Y194-0.4A; Eco R I cut out a complete full-length DNA from pGEM-T-Y194 and inserted it into the corresponding site of pBinPLUS-Y194-0.4A to obtain an invasive clone of pBinPLUS-Y194-1.4A.

Embodiment 3

[0046] Example 3 Transformation of Agrobacterium by electric shock with recombinant vector

[0047] The recombinant plant expression vector was introduced into the Agrobacterium host cell EHA105 by electric shock. First, the competent cells of EHA105 need to be prepared. Pick a single colony of Agrobacterium EHA105 and inoculate it in 5 mL of YEP liquid medium containing 40 μg / mL rifampicin (Rif), culture at 28°C and 200 rpm until OD600≈0.6, collect enough bacteria with a 1.5 mL centrifuge tube, Centrifuge at 8,000 rpm at 4°C for 1 min, discard the supernatant; use 200 μL ddH 2 O was fully resuspended, centrifuged at 8,000 rpm at 4°C for 1 min, and the supernatant was discarded. After repeating three times, the supernatant was discarded; 2 O Sufficiently resuspended, namely Agrobacterium competent cells. Take 10 μL of the recombinant plasmid pBinPLUS-Y194-1.4A and add it to 200 μL of Agrobacterium tumefaciens competent cells, mix gently, transfer to an electric shock cup,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses isolation and identification of Yunnan tomato leaf curl viral genome and agrobacterium tumefaciens-mediated infective clone construction thereof. Total DNA of a genome of an infected tomato is extracted, virus total genomic DNA is cloned by using PCR (Polymerase Chain Reaction), and a total genomic sequence of a Yunnan tomato leaf curl virus is obtained through sequence measurement. 1.4 direct repeated genomes are obtained through methods of PCR and restriction enzyme digestion and are inserted into a plant expression carrier pBinPLUS with high replication capacity, a recombinant carrier is imported with agrobacterium tumefaciens strains EHA105 with strong infection capacity through an electroporation method, therefore, the agrobacterium tumefaciens-mediated infective clone has high-efficiency infection capacity to a host plant. The invention provides a matured method and system for researching interaction among the host plant, a virus infecting medium and a virus, field detection, genome structure and function research of the Yunnan tomato leaf curl virus.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the isolation and identification of Yunnan tomato leaf curl virus genome and a method for constructing an infective clone. Background technique [0002] Geminivirus is a kind of plant single-stranded DNA virus that occurs widely in the world. Virus particles are in the form of typical doublet particles, with a size of about 18-20 nm×30 nm. The genome is single-stranded circular DNA. It generally occurs in tropical and subtropical regions, and occasionally occurs in temperate regions. It is transmitted by insect vectors in a persistent manner, and most of them infect the phloem tissue of host plants. Based on differences in genome structure, insect vectors, and host ranges, the International Committee on Taxonomy of Viruses classified Geminiviridae ( Geminiviridae ) are divided into four genera: Zeavirus ( Mastrevirus ), Betavirus ( Curtovirus ), tomato pseudocurvy virus ( Topo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C12N15/34C12N15/82C12Q1/70C12Q1/68A01H5/00G01N33/569
Inventor 谢艳周雪平矫晓阳吴建祥
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap