Oligonucleotide probe, and method for detecting target molecule through using it

An oligonucleotide probe and target molecule technology, which is applied in the field of oligonucleotide probe and warm nucleic acid probe technology to detect target molecules, can solve the problems of high price and complicated operation.

Active Publication Date: 2012-12-19
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF4 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods all realize the detection of the amplified target molecular signal by modifying the fuel molecules in the hybridization chain reaction system, which is expensive, complicated to operate, and absolutely dependent on the instrument

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide probe, and method for detecting target molecule through using it
  • Oligonucleotide probe, and method for detecting target molecule through using it
  • Oligonucleotide probe, and method for detecting target molecule through using it

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1, carry out probe design based on an artificially synthesized target nucleic acid molecule (combined with the attached figure 1 )

[0062] Artificially synthesized target nucleic acid DNA sequence T1:

[0063] 5'-TCTCCACAACTGAACACGTTAGACCACTT-3' (SEQ ID NO 2).

[0064] The target nucleic acid RNA sequence T1-R obtained by T1 transcription:

[0065] 5'-UCUCCACAACUGAACACGUUAGACCACUU-3' (SEQ ID NO 3).

[0066] (The double-underscored sequence is named sequence a, and the unmarked part is sequence b.)

[0067] The probe sequences designed according to T1 and T1-R are:

[0068] A. Hairpin GAa1

[0069] 5'- TCTAACGTGTTCAGTTGTGGA T TCCACAACTGAACACGTTAGA-3' (SEQ ID NO 4).

[0070] Sequence composition, relationship between each part and naming instructions:

[0071] ① The double underlined sequence at the 5'-end is a cohesive end, which is complementary to the double-underlined sequence at the 3'-end of the target nucleic acid T1, named sequence ...

Embodiment 2

[0080] Embodiment 2, use the probe described in embodiment 1 to detect target nucleic acid

[0081] (1) ABTS chromogenic method detects different concentrations of target nucleic acids

[0082] ①Reaction system (TV=20μL)

[0083] Table 2 Hybrid chain reaction system used in ABTS chromogenic method

[0084]

[0085] Note: X represents the different volumes of target nucleic acid stock solutions added, Y represents the different target nucleic acid final concentrations corresponding to X, respectively 0M, 7.5x10 -9 M,1.5x10 -8 M,3x10 -8 M,5x10 -8 M,7.5x10 -8 M, 1x10 -7 M.

[0086] ②Probe pretreatment

[0087] The probes—hairpins GAa1 and GA2—need to be pretreated before detection. The pretreatment method is: divide the amount of NaCl required for the reaction into two equal parts, and mix it with the hairpin GAa1 and GA2 respectively (taking the amount required for one reaction as an example: 1 μL GAa1 (10 μM) mixed with 1 μL NaCl (4M), 1 μL GA2 (10μM) mixed with 1μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a signal amplification and signal reporting integrated oligonucleotide probe. The probe is a pair of DNA hairpin sequences designed on the basis of a target molecule and having cohesive ends, substantially is a product combining a hybridization chain reaction fuel molecule with a G-quadruplex sequence, has the characteristic of target molecule signal cascade amplification of the hybridization chain reaction in an enzyme-free isothermal manner, and enables the amplified target molecule signal to be conveniently and simply detected through the introduction of a signal reporting element G-quadruplex sequence. The invention also provides a method of an enzyme-free isothermal nucleic acid probe mediated by the above probe. The method enables the signal of an object to be detected to be amplified and detected under a normal temperature condition without any enzymes, and has the advantages of sensitivity, accuracy, simplicity, and easy implementation.

Description

technical field [0001] The invention relates to nucleic acid probe technology, in particular to an oligonucleotide probe integrating signal amplification and signal reporting and an enzyme-free isothermal nucleic acid probe technology mediated by the probe to detect target molecules Methods. Background technique [0002] A nucleic acid probe is a nucleic acid molecule that can specifically bind to a target molecule and convert the signal of the target molecule into a signal for subsequent detection. The technology of using nucleic acid probes to detect and analyze target molecules is called nucleic acid probe technology. Nucleic acid probe technology is a powerful tool for qualitative and quantitative analysis of nucleic acids, and is currently widely used in disease diagnosis and prevention, clinical microbiology, population genetics, forensic science, food safety and other fields. [0003] For a very small amount of nucleic acid target molecules, in order to improve the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor唐卓董娟
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S