Actinobacillus pleuropneumoniae LAMP kit and application method thereof

A technique for pleuropneumoniae and actinobacillus is applied in the field of veterinary biological products, which can solve the problems of long time and expensive equipment, and achieve the effects of short reaction time, simple operation and high sensitivity

Inactive Publication Date: 2013-02-13
SICHUAN AGRI UNIV +1
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to overcome the problems of expensive equipment and long time consumption in the existing PCR technology for detecting porcine infectious pleuropneumoniae, the present invention provides a LAMP detection method for porcine infectious pleuropneumoniae Actinobacillus, which can be used in a short time It can detect trace amounts of porcine infectious Actinobacillus pleuropneumoniae within a short period of time, and the required time is 3 times shorter than that of PCR, and the sensitivity is more than 100 times that of conventional PCR detection, and does not require expensive PCR equipment. The by-product magnesium pyrophosphate precipitates at the bottom of the tube to produce a white precipitate) to identify a positive reaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Actinobacillus pleuropneumoniae LAMP kit and application method thereof
  • Actinobacillus pleuropneumoniae LAMP kit and application method thereof
  • Actinobacillus pleuropneumoniae LAMP kit and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention will be described in detail below in conjunction with specific embodiments.

[0025] 1. Search for specific gene sequences

[0026]Landed at the National Center for Biotechnology (NCBI) in the United States, and retrieved the disulfide bound formation protein E (dsbE) protein gene sequence (AF458418, AF458420, AF458421, AF458422, AF458423, AF458425, AF458426, AF458427, AF458428, AF458429, AF458430, AF458431, AF458432, AF458433), and then compared by Blast and AlignX software to find out the highly conserved regions in 1-14 sera. The specific sequence found is as follows: TACCTTTATTATTGTTGATT GCACTGGTAG CGTTTTTAAC CGTGCCGTTA ATGAATAAGG ATGCCCTTTC GCTGACCGAAGATTGGCGAG ATAAACCTTT TCCGGAATTT GTCGGTAAAA ATTTACTCGA TCATAATGCG CATATTAATAATAACAGTTT GCCGAAAGAG CCTTATATTT TGTAACGTAATTG GGCAAGTTGGG

[0027] 2. Design of LAMP primers

[0028] Log on to the webpage https: / / primerexplorer.jp / e / , and design the primers involved in the present invention through ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a LAMP kit used for detecting actinobacillus pleuropneumoniae, and an application method thereof. The kit comprises 50mul of 8U / mul BstDNA polymerase, 125mul of a BstDNA polymerase buffer solution, 100mul of 0.1mol / l MgSO4, 100mul of 12.5mmol / l betaine, 100mul of 17.5mmol / l dNTP, and primers. As a result of multiple times of tests of practice, with the kit, trace amount of various serotypes of actinobacillus pleuropneumoniae can be detected specifically, sensitively, fast, and highly efficiently in a 63-64 DEG C constant-temperature water-bath pot. The method does not need complicated instrument and large amounts of professional skills, such that an urgent need currently of actinobacillus pleuropneumoniae field detection can be satisfied. The kit and the method can be used in field detections of import and export quarantine, food sanitation departments, animal husbandry farms, and the like. The kit and the method are especially suitable to be used by grassroots veterinary workers for carrying out wild and real-time detections of actinobacillus pleuropneumoniae.

Description

technical field [0001] The invention belongs to the disease diagnosis technology in the field of veterinary biological products, and in particular relates to a LAMP kit for simple and rapid detection of Actinobacillus pleuropneumoniae and its use method. Background technique [0002] Actinobacillus pleuropneumoniae (Actinobacillus pleuropneumoniae) is a Gram-negative small coccus belonging to the Pasteurellaceae Actinobacillus genus. Actinobacillus pleuropneumoniae can be divided into two biotypes according to the dependence on nicotinamide adenine dinucleotide (NAD) during growth, namely biological type I and biological type II, wherein biological type I has a greater impact on pigs. Pathogenic. According to the difference between capsular polysaccharide and lipopolysaccharide, biological type I can be divided into 15 serotypes, serotype 1 is further divided into two subtypes 1a and 1b, and serotype 5 is further divided into 5a and 5b subtypes. The cross-protection among ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12R1/01
Inventor 徐志文朱玲季洪伟杨宏伟周远成
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products