Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetically engineered bacterium WSD2CP of azinomycin B as well as preparation method and application thereof

A technology of genetically engineered bacteria and azithromycin, which is applied to the genetically engineered bacteria WSD2CP of azithromycin B, the application of genetically engineered bacteria WSD2CP in fermentation production, and the field of preparation of genetically engineered bacteria WSD2CP, which can solve the problem of azithromycin B. The problem of unstable nature of oxalophane B, the research and application of azithromycin, etc., has achieved the effect of great application value and stable oxin-producing ability.

Inactive Publication Date: 2014-11-19
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the nature of azithromycin B is extremely unstable, and it is difficult to obtain a stable source of natural products from its producing bacteria, Streptomyces sahachiroi, which brings certain problems to the research and application of the biological activity of azithromycin B.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium WSD2CP of azinomycin B as well as preparation method and application thereof
  • Genetically engineered bacterium WSD2CP of azinomycin B as well as preparation method and application thereof
  • Genetically engineered bacterium WSD2CP of azinomycin B as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A preparation method of genetically engineered bacteria WSD2CP of azithromycin B, the basic steps of which are:

[0037] (a) From the genome library of Streptomyces sahachiroi ATCC33158 (purchased from ATCC, American Type Culture Collection), a clone containing the biosynthetic gene cluster fragment of the antibiotic azithromycin B was screened as the PCR template required for construction, and primers were screened (AZI3forward upstream primer, GTGCCGGAGGACGTAACCAACTGT; AZI3reverse downstream primer, CGAGGCGGCGAGGAGATAGA) are specific primers designed according to the published sequence (GenBank's sequence number is EU240558); (b) construct a recombinant vector with aziD2 gene deletion; (c) transfer by conjugation Transfer the recombinant vector obtained in step (b) to Streptomyces; (d) Obtain Streptomyces strain WSD2 with aziD2 gene deletion through resistance screening; (e) Construct aziD2 using pMSB-WS052 (laboratory constructed vector) as the starting vector Gene e...

Embodiment 2

[0039] A kind of application of the genetic engineering bacterium WSD2CP of azithromycin B in fermentation production, its application process is:

[0040] (1) Using solid fermentation and extraction technology to analyze the production levels of wild-type strains and genetically engineered bacteria

[0041] Inoculate wild-type strains and genetically engineered bacteria WSD2 and WSD2CP on solid medium PS5, culture at 30°C for 5 days until spore production, collect spores into 2ml 20% (v / v) glycerin solution, take 10ul spore liquid for dilution and counting , isocratic inoculation for fermentation. GYM is selected as the medium for solid fermentation (see the content of the invention for the medium formula), and equal amounts of each strain are inoculated in 25ml of solid fermentation medium. When cultured at 30°C for 2-3 days, the biological activity of the bacterial block is measured with Bacillus subtilis as an indicator bacterium. ( figure 2 ), it can be judged that azi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineering bacterium WSD2CP of azinomycin B as well as a preparation method and an application thereof. The preparation method of the genetically engineering bacterium WSD2CP of azinomycin B comprises the following steps of: A, constructing an aziD2 gene deletion mutant strain in StreptomycessahachiroiATCC33158, namely introducing recombinant plasmid with an aziD2 gene deleted into a wild type strain to obtain an aziD2 gene deletion mutant strain, wherein a 1.0kb characteristic strip can be amplified by total DNA (deoxyribose nucleic acid) of the aziD2 gene deletion mutant strain; B, constructing an aziD2 gene expression plasmid based on streptomycete expression plasmid, namely after carrying out enzyme digestion on an aziD2 gene segment by virtue of an XbaI+SpeI enzyme, inserting the aziD2 gene segment into a site XbaI at the downstream of a carrier constitutive strong promoter PermE* to obtain an aziD2 gene expression plasmid; and C, constructing an aziD2 gene complementary expression strain, namely introducing the aziD2 gene expression plasmid into an aziD2 gene deletion strain, and amplifying a 1.1kb characteristic strip by taking total DNA of a complementary strain as a template, so that a complementary aziD2 gene strain WSD2CP is obtained. The preparation method of the genetically engineering bacterium WSD2CP of azinomycin B is easy and simple to operate, and expression quantity of the aziD2 gene is increased, so that yield of azinomycin B is increased.

Description

technical field [0001] The present invention relates to the technical field of genetic bioengineering, more specifically to a genetically engineered bacterium WSD2CP of azithromycin B, and also to a method for preparing a genetically engineered bacterium WSD2CP of azithromycin B, and to an azin Application of genetically engineered bacteria WSD2CP of mycin B in fermentation production. Background technique [0002] Microorganisms are an important source of many natural active products. At present, about 70%-80% of the active substances with efficacy in anti-tumor, anti-fungal, anti-bacterial, anti-parasitic, etc. are derived from Streptomyces (Berdy, J., 2005 .Bioactive microbial metabolites.J.Antibiot.58,1–26), therefore, Streptomyces has great commercial application value. However, the biosynthesis of these natural products by wild-type strains is usually not up to the requirements of industrial development (Parekh S, Vinci VA, Strobel RJ, 2000, Improvement of microbial s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/76C12P21/02C12R1/465
Inventor 何璟王珊
Owner HUAZHONG AGRI UNIV