Genetically engineered bacterium WSD2CP of azinomycin B as well as preparation method and application thereof
A technology of genetically engineered bacteria and azithromycin, which is applied to the genetically engineered bacteria WSD2CP of azithromycin B, the application of genetically engineered bacteria WSD2CP in fermentation production, and the field of preparation of genetically engineered bacteria WSD2CP, which can solve the problem of azithromycin B. The problem of unstable nature of oxalophane B, the research and application of azithromycin, etc., has achieved the effect of great application value and stable oxin-producing ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] A preparation method of genetically engineered bacteria WSD2CP of azithromycin B, the basic steps of which are:
[0037] (a) From the genome library of Streptomyces sahachiroi ATCC33158 (purchased from ATCC, American Type Culture Collection), a clone containing the biosynthetic gene cluster fragment of the antibiotic azithromycin B was screened as the PCR template required for construction, and primers were screened (AZI3forward upstream primer, GTGCCGGAGGACGTAACCAACTGT; AZI3reverse downstream primer, CGAGGCGGCGAGGAGATAGA) are specific primers designed according to the published sequence (GenBank's sequence number is EU240558); (b) construct a recombinant vector with aziD2 gene deletion; (c) transfer by conjugation Transfer the recombinant vector obtained in step (b) to Streptomyces; (d) Obtain Streptomyces strain WSD2 with aziD2 gene deletion through resistance screening; (e) Construct aziD2 using pMSB-WS052 (laboratory constructed vector) as the starting vector Gene e...
Embodiment 2
[0039] A kind of application of the genetic engineering bacterium WSD2CP of azithromycin B in fermentation production, its application process is:
[0040] (1) Using solid fermentation and extraction technology to analyze the production levels of wild-type strains and genetically engineered bacteria
[0041] Inoculate wild-type strains and genetically engineered bacteria WSD2 and WSD2CP on solid medium PS5, culture at 30°C for 5 days until spore production, collect spores into 2ml 20% (v / v) glycerin solution, take 10ul spore liquid for dilution and counting , isocratic inoculation for fermentation. GYM is selected as the medium for solid fermentation (see the content of the invention for the medium formula), and equal amounts of each strain are inoculated in 25ml of solid fermentation medium. When cultured at 30°C for 2-3 days, the biological activity of the bacterial block is measured with Bacillus subtilis as an indicator bacterium. ( figure 2 ), it can be judged that azi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 