Skeletal Muscle Chloride Channel Gene Mutant and Its Application

A chloride ion channel, skeletal muscle technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of congenital myotonia that need to be further deepened

Active Publication Date: 2017-06-06
BGI GENOMICS CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Therefore, the current research on myotonia congenita remains to be in-depth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Skeletal Muscle Chloride Channel Gene Mutant and Its Application
  • Skeletal Muscle Chloride Channel Gene Mutant and Its Application
  • Skeletal Muscle Chloride Channel Gene Mutant and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Target region capture sequencing to determine the mutation site

[0051] Sample collection: Collect peripheral blood from patient 1, patient 2 and their parents (peripheral blood from patient 1's parents cannot be collected), and use QIAamp DNA BloodMiNi Kit (Qiagen, Hilden, Germany) to extract genomic DNA as samples. Among them, patient 1 was diagnosed as congenital myotonia by the hospital, with typical myotonia, and his parents were normal; patient 2, a Cantonese, was diagnosed with tuberous sclerosis when he was 8 months old. He was 2 years and 8 months old (his parents had signed the informed consent form), and his clinical manifestations were: no hearing, no language ability, no walking, weak spine, and unable to stand upright for a long time. In addition, in this embodiment, the peripheral blood of 135 normal people was collected and their genomic DNA samples were extracted by the above-mentioned method, as a control.

[0052] The genomic DNA samples c...

Embodiment 2

[0064] Example 2 Sanger method sequencing to verify the mutation sites of patient 1 and patient 2

[0065] Using the genomic DNA samples of patient 1 and 135 normal persons collected in Example 1, the CLCN1 gene mutation site of patient 1 obtained above was verified by Sanger sequencing according to the following steps:

[0066] 2.1 Primer design and PCR reaction

[0067] First, referring to the human genome sequence database hg19 / build36.3, the exon-specific primers of the skeletal muscle chloride ion channel gene (ie, CLCN1 gene) having the nucleotide sequence shown in SEQ ID NO: 3-32 were designed (see aforementioned Table 1). Wherein, the exon-specific primers are specific to 23 exons of CLCN1 and their adjacent intron sequences.

[0068] Then, configure the PCR reaction system of each genomic DNA sample according to the following ratio:

[0069]

[0070] Then, each PCR reaction system was carried out PCR reaction according to the following reaction conditions respec...

Embodiment 3

[0076] Example 3 Sanger method sequencing to verify the mutation sites of patients 1 and 2

[0077] Using the patient 2 and his parents collected in Example 1, and the genomic DNA samples of 135 normal people, according to the steps of Sanger method sequencing verification described in Example 2, the CLCN1 gene mutation site of the aforementioned patient 2 Sequencing verification by Sanger method. Wherein, the primers that PCR reaction adopts are different, and the PCR primers that the present embodiment adopts is:

[0078] (a) c.2057_2058delAC mutation site primer sequence

[0079] Upstream primer: GGCGCCTCTCCTGTTCCTT (SEQ ID NO: 33);

[0080] Downstream primer: GGAATTGCATGCAGGTCAAGG (SEQ ID NO: 34).

[0081] (b) Sequence of primers for p.Arg105Cys (i.e. c.313C>T) mutation site

[0082] Upstream primer: CGTTTCTTCCTAGATTGTATCCACC (SEQ ID NO: 35);

[0083] Downstream primer: GGAGGGGCGTGAGAAGTGG (SEQ ID NO: 36).

[0084] Thus, the alignment results of the skeletal muscle c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a separated nucleic acid of encoded skeletal muscle chloride ion channel mutants, an isolated polypeptide, a method for screening a myotonia congenital disease susceptible biological sample, a system for screening a myotonia congenital disease susceptible biological sample and a kit for screening a myotonia congenital disease susceptible biological sample. Specifically, the separated nucleic acid of encoded skeletal muscle chloride ion channel mutants, compared with the SEQ ID NO:1, has at least one mutation selected from the following: c.2655_2656insC, c.1616C>T, c.2057_2058delAC and c.313C>T. By detecting the existence of the new mutants in the biological sample, whether the biological sample is susceptible to a myotonia congenital disease can be effectively detected.

Description

technical field [0001] The invention relates to a skeletal muscle chloride ion channel gene mutant and application thereof. Specifically, the present invention relates to isolated nucleic acids encoding skeletal muscle chloride ion channel mutants, isolated polypeptides, methods for screening biological samples susceptible to congenital myotonic diseases, and systems for screening biological samples susceptible to congenital myotonic diseases And a kit for screening biological samples for susceptibility to myotonia congenita. Background technique [0002] Myotonia congenital (MC) is a hereditary myopathy with skeletal muscle stiffness and hypertrophy as the main clinical manifestations. Most of them develop at birth or in early childhood, and a few have onset in adolescence. The incidence rate is 0.3-0.6 / 100,000, that is, there are about 3,000-6,000 MC patients in China. According to different genetic patterns, MC can be divided into Thomsen disease (autosomal dominant inh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/12C07K14/47C12Q1/68C12M1/34
Inventor王金明王俊汪建杨焕明
OwnerBGI GENOMICS CO LTD