ds RNA inhabiting expression of chloride channel gene of aphid and application thereof

A chloride ion channel and gene expression technology, applied in the field of dsRNA that inhibits the expression of aphid chloride ion channel genes, can solve the problems of lack of anti-aphid genes, environmental pollution, harmfulness to humans and animals, etc.

Inactive Publication Date: 2016-01-20
NANYANG NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the control of aphids is mainly based on spraying pesticides, but a large amount of pesticides are not only harmful to humans and animals, but also cause serious environmental pollution.
Breeding insect-resistant crop varieties is the most effective way to prevent aphid damage, but due to the lack of effective aphid-resistant genes in the existing germplasm resources of crops, and the resistance mechanism is not clear, conventional insect-resistant breeding is difficult to work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ds RNA inhabiting expression of chloride channel gene of aphid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Aphids SaCIC4 Gene dsRNA acquisition

[0037] (1) Extraction of total RNA and synthesis of cDNA

[0038] About 20 tube aphids were taken, and total RNA was extracted according to the instructions of the Trizol kit of Beijing Quanshijin Company, purified with RNACleaningKit, and the first strand of cDNA was synthesized by reverse transcription. The operation steps refer to the instructions of the kit.

[0039] (2) Primer design and gene cloning

[0040] Primers P1-F and P1-R were designed using PrimerPrimer5.0 software and synthesized by Beijing Huada Gene Company. GFP gene ( GFP ) fragment was amplified from the 16318hGFP plasmid preserved in the laboratory of the School of Life Science and Technology, Nanyang Normal University, and primers P2-F and P2-R were designed using PrimerPrimer5.0 software.

[0041] P1-F: 5'- TAATACGACTCACTATAGGG GAAAATGAAAAAATCGAAAG-3' (the underlined sequence is the 1st to 20th positions of SEQ ID No: 2);

[0042] P1-R:...

Embodiment 2

[0059] Example 2 SaCIC4 Application of dsRNA in inhibiting the growth of aphids

[0060] (1) Preparation of artificial feed for aphids and preparation of feeders

[0061] References for preparation of artificial feed and feeder (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. A study on feeding aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.) , filter the artificial feed with a 0.2μm bacterial filter, dispense it into 2.0mL sterilized centrifuge tubes and store in a -20°C refrigerator to avoid repeated freezing and thawing.

[0062] (2) dsRNA ( SaCIC4 dsRNA) in inhibiting the growth of aphids

[0063] Aphid feeding methods refer to the following documents: Jiao Min, Liu Shusheng. The technology of using artificial feed to raise aphids. Entomological Journal of East China, 2004,13(2):102-109.

[0064] Aphid aphid SaCIC4 dsRNA feeding group: put 20 3rd-instar nymphs of A. sativa in each aphid feeder, and add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a ds RNA inhabiting expression of chloride channel gene of aphid and an application thereof. Particularly, the ds RNA inhabiting expression of chloride channel gene of aphid is a double-stranded RNA composed of nucleotide of sequences represented by SEQ ID No:1 and the nucleotide of reverse complementary sequences. The application is that the ds RNA is introduced into aphid so as to prevent and control aphid, reduce aphid survival rate or inhabit expression of chloride channel gene of aphid. The invention uses the method of in vitro ds RNA feeding, and adopts the RNA i technology to silence expression of chloride channel gene of sitobion avenae to produce lethal effect on sitobion avenae. According to real-time fluorescence quantitative PCR study on chloride channel gene of aphid after feeding, expression of chloride channel gene is remarkably inhabited. The invention shows that sequences of chloride channel gene of aphid can be applied to research on increasing wheat resistance to aphids through plant mediating RNA i technology.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a dsRNA for inhibiting the expression of aphid chloride ion channel gene and application thereof. Background technique [0002] Aphids are one of the main pests that endanger crop production. In recent years, factors such as global warming and changes in farming systems have significantly enhanced the reproductive capacity and adaptability of aphids. The damage is becoming more and more serious, causing hundreds of millions of economic losses every year. Taking wheat aphids as an example, wheat aphids gather as nymphs on wheat leaves, stems, ears, etc., and suck juice, causing irregular shrinkage, curling, and chlorosis of leaves, and in severe cases, plant death. The honeydew secreted by the wheat aphid adheres to the surface of the plant, reduces the photosynthesis of the plant, and easily induces soot disease. At the same time, wheat aphid is also an import...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11A01N57/16A01P7/04
Inventor 喻修道刘宗才段鹏飞陈志勤雷霆
Owner NANYANG NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap