Acyl-coenzyme A synthetase and application thereof

A technology for synthesizing enzymes and coenzymes, applied in the field of enzyme engineering, can solve the problems that the biochemical functions of proteins have not yet been identified

Active Publication Date: 2014-04-16
WUXI NEWWAY FERMENTATION TECH RES INST
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biochemical functions of the above proteins have not yet been identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acyl-coenzyme A synthetase and application thereof
  • Acyl-coenzyme A synthetase and application thereof
  • Acyl-coenzyme A synthetase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction and expression of embodiment 1 Indian ghost pepper ACS1 genetically engineered bacteria

[0037] Using ACS1-sumo-F and ACS1-sumo-R primers to amplify the ACS1 gene of the cDNA of the green fruit of the Indian ghost pepper, the sequences of the above two primers are: CGC GAA CAG ATT GGA GGT GCAACAGATAAATTTATTATTG and GTG GCG GCC GCT CTA TTA TCACTTGGTACCCTTGTACAT . PCR amplification products were purified with 1% agarose gel and mixed with linearized pETite N-His SUMO Kan expression vector (Lucigen, Middleton, WI). The DNA mixture was transformed into E. coli HI-control10G cells (Lucigen) by heat shock method. Sequence the inserted gene to ensure its sequence is correct. The encoded amino acid sequence is shown in SEQ ID NO.1. The pETiet N-His SUMO-Pipano pepper ACS1 gene was transformed into HI-Control BL21(DE31) cells (Lucigen), and the expression of His-SUMO-ACS1 was induced with 0.5mM IPTG at 16°C for 20 hours. Mixed proteins were purified by Ni-NTA c...

Embodiment 2A

[0038] Example 2 ACS1 Activity Determination

[0039] The activity of ACS1 in ghost pepper was determined by HPLC (Chen et al., 2011). Specifically, the reaction mixture (400 μL) included 0.1 M Tris-HCl, pH 7.5, 2 mM DTT, 5 mM ATP, 10 mM MgCl2, 0.5 mM CoA, 0.1% trinitrotoluene and 200 μM carboxylic acid. The reaction was initiated by adding 20 μL of purified enzyme and terminated by adding 20 μL of acetic acid after 30 minutes of reaction. HPLC use 3000LC system (Thermo Scientific), using 120C18 reverse-phase chromatographic column (Thermo Scientific; 3μ, 150x3mm). The mobile phase consisted of solvent A (0.1% trifluoroacetic acid) and solvent B (acetonitrile). The gradient elution program was as follows: 0 to 5 minutes, 5% solvent B; 5 to 9 minutes, linearly increasing solvent B concentration from 5% to 80%; 9 to 11 minutes, 80% solvent B concentration; 11 to 12 minutes, Solvent B concentration 5%. The flow rate was 0.6 mL / min. The detection range of the diode arra...

Embodiment 3

[0040] The selection of embodiment 3ACS action substrate

[0041] Add 5 mM acetic acid, butyric acid, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid and stearic acid to the enzyme reaction system respectively.

[0042] Such as figure 2 As shown, among the different substrates, capric acid is the highest activity of Indian pepper ACS1. In contrast, ACS1 had no activity against acetate and butyrate.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses acyl-coenzyme A synthetase and an application thereof. The amino acid sequence of the acyl-coenzyme A synthetase is as shown in SEQ ID No.1. Further, genetically engineered bacteria capable of secreting the acyl-coenzyme A synthetase can be established, and the acyl-coenzyme A synthetase can be produced by fermentation of recombinant bacteria. The acyl-coenzyme A synthetase disclosed by the invention is the first enzyme which has been ever found to have an activity on trans-8-methyl-6-nonenoic acid or 8-metyl nonanoic acid, and provides a direct substrate for cloning capsaicinoid synthetase. The acyl-coenzyme A synthetase disclosed by the invention has an activity on medium-chain fatty acid and can also be applied to the field of biodiesel.

Description

technical field [0001] The invention relates to an acyl-CoA synthetase and its application, belonging to the technical field of enzyme engineering. Background technique [0002] Capsaicin, scientific name trans-8-methyl-N-vanillyl-nonenamide, is a secondary metabolite with pungent taste of pepper (Capsicum genus). Capsaicin is synthesized by capsaicin synthase (CS), an acyltransferase. Although the gene encoding CS has not yet been deciphered, its main role is known to be the transfer of 8-methylnonenoyl-CoA from 8-methylnonenoyl-CoA to vanillylamine, thereby forming an amide complex. The substrate of CS, 8-methylnonenoyl, is converted from trans-8-methyl-6 nonenoyl acid under the action of acyl-CoA synthetase (ACS). [0003] ACS catalyzes the conversion of carboxylic acid to the corresponding acyl-CoA thioester through two stages. In the first stage, free fatty acids are converted to an acyl-AMP intermediate that releases pyrophosphate. In the second stage, the activate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/70C12N1/21C12P19/32C12R1/19
CPCC12N9/1029C12P19/32C12Y203/01086
Inventor陈辉王泓雪余晓丹
OwnerWUXI NEWWAY FERMENTATION TECH RES INST