An auxin response factor gene that regulates the development of poplar adventitious roots and its application

A technology of response factors and auxin, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of gene function differentiation, loss, gene family expansion, etc., and achieve the effect of early rooting and increased number

Inactive Publication Date: 2018-06-05
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few reports on the mechanism of auxin response factors regulating adventitious root development in woody plants. In addition, because of the genome duplication events in woody plants that are different from those in herbaceous plants, some gene families have expanded or lost, and some gene families have been expanded or lost. Gene function diverges

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An auxin response factor gene that regulates the development of poplar adventitious roots and its application
  • An auxin response factor gene that regulates the development of poplar adventitious roots and its application
  • An auxin response factor gene that regulates the development of poplar adventitious roots and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Cloning of PtARF3.1 Gene

[0023] 84K (P.alba X P.glandulosa) Populus albadensis was used as material, and the total RNA of tissue culture plantlet 84K was extracted using RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany). About 2.0 μg of RNA was taken from each sample to synthesize cDNA first strand by using SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Refer to the published Populus trichocarpa genome sequence, use Primer3 software to design primers (the amplicon includes start codon and stop codon), and perform full-length gene amplification (GATEWAY linker is introduced into the primer).

[0024] Wherein, the PtARF3.1 ORF forward primer is (such as sequence 4 in the sequence listing):

[0025] GGGGACAACTTTGTACAAAAAAGTTGGAATGATAGATCTTAACACAAC,

[0026] The PtARF3.1 ORF reverse primer is (as sequence 5 in the sequence listing):

[0027] GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTACTAAAAGCACACGATGCCAC...

Embodiment 2

[0030] Embodiment 2 PtARF3.1 gene plant expression vector construction

[0031] Utilize pathway cloning technology to construct the overexpression vector of PtARF3.1 gene, use specific PCR primer (PtARF3.1ORF primer of embodiment 1), take 84K cDNA as template, carry out PCR amplification, construct PtARF3.1 gene ORF into entry vector . The entry vector is PDNOR222.1, and the sequence is shown as sequence 6 in the sequence listing. The reaction system is Fresh PCR product80ng; PDNOR222.1vector 0.4μl; BP ClonaseⅡ enzyme mix 0.6μl; sterile ddH 2O to make up to 5 μl. The reaction procedure is: react at 25°C for 5h.

[0032] Pick positive clones from the screening culture plate for PCR detection and sequencing verification. After the entry vector with PtARF3.1 gene is linearized by mlu I restriction endonuclease, it is combined with the plant expression vector PMDC32. The sequence is shown in sequence 7 in the sequence list Shown, carry out LR reaction. The reaction system is:...

Embodiment 3

[0034] The genetic transformation of embodiment 3PtARF3.1 gene

[0035] The constructed PMDC32-PtARF3.1 overexpression vector was transformed into Agrobacterium GV3101 by electric shock method, and the PtARF3.1 gene was transferred into poplar through Agrobacterium. The transformation steps were as follows: hybrid poplar clone 84K for genetic transformation The tissue-cultured seedlings were cultured under conditions of a culture temperature of 23-25° C., a light of 16 / 8 h (day / night), and a light intensity of 50 μM m-2s-1. Agrobacterium containing PMDC32-PtARF3.1 expression vector infects 84K leaf discs at OD600=0.6-0.8. Infected leaf discs were grown on adventitious bud induction medium (SIM, Murashige-Skoog (MS) basal medium supplemented with 0.5 mg / l 6-benzyl aminopurine (6-BA) and 0.05 mg / l naphthalene acetic acid (NAA)), Co-cultivate for 3 days in the dark at a temperature of 22±2°C. The leaf discs after co-cultivation were transferred to SIM containing 3mg / L hygromyci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an auxin response factor gene PtARF3.1 for regulating and controlling adventitious root development of poplar and application thereof, and belongs to the technical field of biological genetic engineering. The nucleotide sequence of the PtARF3.1 is shown by SEQ ID NO:1 in a sequence table; the amino acid sequence of expression protein of the PtARF3.1 is shown by SEQ ID NO:2 in the sequence table; the nucleotide sequence of a carrier PMDC32-PtARF3.1 of the PtARF3.1 is shown by SEQ ID NO:3 in the sequence table. According to the invention, the PtARF3.1 gene is transferred to poplar; compared with wild type poplar, the transgenic poplar with overexpression PtARF3.1 has the advantages that the rooting is ahead of time, and the quantity of adventitious roots is increased, which suggest that the auxin response factor gene PtARF3.1 of poplar is a key regulatory factor for controlling adventitious root generation and development of poplar, and has important application value in the fields of forest-tree genetic engineering and clonal forest.

Description

technical field [0001] The invention relates to an auxin gene for regulating the development of adventitious roots and its application, in particular to an auxin response factor gene PtARF3.1 for regulating the development of adventitious roots in poplar and its application, which belongs to the technical field of biogenetic engineering. The auxin response factor for poplar adventitious roots Gene. Background technique [0002] With the development of genetics, genomics and molecular biology techniques in recent years, poplar has become a model plant for studying wood formation, seasonal variation of perennial plants, growth and development, flowering, sex determination and biological interactions. Poplar itself is an economic tree species widely distributed in the world. It has the characteristics of fast-growing early, strong adaptability, wide distribution, many varieties, easy hybridization, easy improvement of heredity, and easy reproduction, so it is widely used in int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/84C07K14/415C12Q1/6895A01H5/00
Inventor卢孟柱刘颖丽赵树堂周艺华
OwnerINST OF FORESTRY CHINESE ACAD OF FORESTRY