An auxin receptor gene regulating adventitious root development of poplar and its application

A receptor gene and root development technology, applied in the field of plant genetic engineering and biology, to achieve the effect of increasing the number, early rooting, and increasing the total area of ​​adventitious roots

Inactive Publication Date: 2018-06-05
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In woody plants, the mechanisms by which auxin receptors regulate adventitious root development are rarely reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An auxin receptor gene regulating adventitious root development of poplar and its application
  • An auxin receptor gene regulating adventitious root development of poplar and its application
  • An auxin receptor gene regulating adventitious root development of poplar and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of the PtrFBL1 gene

[0025] Using 84K (P.alba X P.glandulosa) Populus albadensis as material, total RNA was extracted from 84K tissue-cultured seedlings cut for 10 days using RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany). About 3.0 μg of RNA was taken from each sample to synthesize cDNA first strand by using SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Refer to the published Populus trichocarpa genome sequence, use Primer 5 software to design primers (the amplicon includes start codon and stop codon), and perform full-length gene amplification (GATEWAY linker is introduced into the primer).

[0026] Wherein, the PtrFBL1ORF forward primer is (such as sequence 3 in the sequence listing):

[0027] GGGGACAACTTTGTACAAAAAAGTTGGAATGTTGAGAAAGGCGAATTC,

[0028] The PtrFBL1ORF reverse primer is (such as sequence 4 in the sequence listing):

[0029] GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCAAGA...

Embodiment 2

[0032] Example 2 PtrFBL1 Gene Plant Expression Vector Construction

[0033]The overexpression vector of PtrFBL1 gene was constructed by cloning technology, using specific PCR primers (PtrFBL1 ORF primer in Example 1), and 84K cDNA was used as a template for PCR amplification, and the PtrFBL1 gene ORF was constructed into the entry vector. The entry vector is PDNOR222.1, and the sequence is shown as sequence 5 in the sequence listing. The reaction system is Fresh PCR product80ng; PDNOR222.1 vector 0.4μl; BP ClonaseⅡenzyme mix 0.6μl; sterile ddH 2 O to make up to 5 μl. The reaction procedure is: react at 25°C for more than 5h.

[0034] Pick positive clones from the screening culture plate for PCR detection and sequencing verification. After the entry vector with PtrFBL1 gene is linearized by Mlu I restriction endonuclease, it is combined with the plant expression vector PMDC32. The sequence is as shown in sequence 6 in the sequence listing. Shown, carry out LR reaction. The ...

Embodiment 3

[0036] The genetic transformation of embodiment 3PtrFBL1 gene

[0037] The constructed PMDC32-PtrFBL1 overexpression vector was transformed into Agrobacterium GV3101 by electric shock method, and the PtrFBL1 gene was transferred into poplar through Agrobacterium-mediated transformation. The culture temperature is 23-25°C, the light is 16 / 8h (day / night), and the light intensity is 50μM m -2 the s -1 cultivated under conditions. Agrobacterium containing PMDC32-PtrFBL1 expression vector infects 84K leaf discs at OD600=0.6-0.8. Infected leaf discs were placed on adventitious bud induction medium (SIM, Murashige-Skoog (MS) basal medium supplemented with 0.5 mg / l 6-benzylaminopurine (6-BA) and 0.05 mg / l naphthalene acetic acid (NAA)), Co-cultivate for 3 days in the dark at a temperature of 23±2°C. The co-cultured leaf discs were transferred to SIM containing 3 mg / L hygromycin B and 200 mg / L Timentin, and the culture temperature was 23-25 ​​° C, the light was 16 / 8 h (day / night), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an auxin receptor gene for regulating the development of adventitious roots of poplar and its application, belonging to the fields of plant genetic engineering and biotechnology. The nucleotide sequence of PtrFBL1 is shown in sequence 1 in the sequence listing; the amino acid sequence of the expressed protein of PtrFBL1 is shown in sequence 2 in the sequence listing. The present invention transfers the PtrFBL1 gene into 84k poplar, and compared with the wild type, the transgenic poplar overexpressing PtrFBL1 obviously takes root earlier, and the number of adventitious roots increases significantly, the total length of adventitious roots and the total area of ​​adventitious roots increase significantly, indicating that the PtrFBL1 gene regulates poplar The key regulator gene of adventitious root development has important application value in the field of tree genetic engineering and clonal forestry.

Description

technical field [0001] The invention relates to an auxin gene regulating adventitious root development and its application, in particular to an auxin receptor gene PtrFBL1 regulating the adventitious root development of poplar and its application, which belongs to the field of plant genetic engineering and biotechnology. Background technique [0002] With the development of molecular biology techniques and the completion of poplar genome sequencing in recent years, poplar has become a model plant for studying wood formation, growth and development, seasonal variation, sex determination, flowering and biological interactions of perennial plants. . Poplar itself is an economic tree species widely distributed in the world. It is not only an important wood raw material, but also an important energy plant. It has wide distribution, strong adaptability, early fast-growing, easy hybrid improvement and reproduction, etc. characteristics, so it is widely used in fast-growing wood cu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/06
Inventor卢孟柱舒文波赵树堂
OwnerINST OF FORESTRY CHINESE ACAD OF FORESTRY