An auxin receptor gene regulating adventitious root development of poplar and its application
A receptor gene and root development technology, applied in the field of plant genetic engineering and biology, to achieve the effect of increasing the number, early rooting, and increasing the total area of adventitious roots
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Cloning of the PtrFBL1 gene
[0025] Using 84K (P.alba X P.glandulosa) Populus albadensis as material, total RNA was extracted from 84K tissue-cultured seedlings cut for 10 days using RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany). About 3.0 μg of RNA was taken from each sample to synthesize cDNA first strand by using SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Refer to the published Populus trichocarpa genome sequence, use Primer 5 software to design primers (the amplicon includes start codon and stop codon), and perform full-length gene amplification (GATEWAY linker is introduced into the primer).
[0026] Wherein, the PtrFBL1ORF forward primer is (such as sequence 3 in the sequence listing):
[0027] GGGGACAACTTTGTACAAAAAAGTTGGAATGTTGAGAAAGGCGAATTC,
[0028] The PtrFBL1ORF reverse primer is (such as sequence 4 in the sequence listing):
[0029] GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCAAGA...
Embodiment 2
[0032] Example 2 PtrFBL1 Gene Plant Expression Vector Construction
[0033]The overexpression vector of PtrFBL1 gene was constructed by cloning technology, using specific PCR primers (PtrFBL1 ORF primer in Example 1), and 84K cDNA was used as a template for PCR amplification, and the PtrFBL1 gene ORF was constructed into the entry vector. The entry vector is PDNOR222.1, and the sequence is shown as sequence 5 in the sequence listing. The reaction system is Fresh PCR product80ng; PDNOR222.1 vector 0.4μl; BP ClonaseⅡenzyme mix 0.6μl; sterile ddH 2 O to make up to 5 μl. The reaction procedure is: react at 25°C for more than 5h.
[0034] Pick positive clones from the screening culture plate for PCR detection and sequencing verification. After the entry vector with PtrFBL1 gene is linearized by Mlu I restriction endonuclease, it is combined with the plant expression vector PMDC32. The sequence is as shown in sequence 6 in the sequence listing. Shown, carry out LR reaction. The ...
Embodiment 3
[0036] The genetic transformation of embodiment 3PtrFBL1 gene
[0037] The constructed PMDC32-PtrFBL1 overexpression vector was transformed into Agrobacterium GV3101 by electric shock method, and the PtrFBL1 gene was transferred into poplar through Agrobacterium-mediated transformation. The culture temperature is 23-25°C, the light is 16 / 8h (day / night), and the light intensity is 50μM m -2 the s -1 cultivated under conditions. Agrobacterium containing PMDC32-PtrFBL1 expression vector infects 84K leaf discs at OD600=0.6-0.8. Infected leaf discs were placed on adventitious bud induction medium (SIM, Murashige-Skoog (MS) basal medium supplemented with 0.5 mg / l 6-benzylaminopurine (6-BA) and 0.05 mg / l naphthalene acetic acid (NAA)), Co-cultivate for 3 days in the dark at a temperature of 23±2°C. The co-cultured leaf discs were transferred to SIM containing 3 mg / L hygromycin B and 200 mg / L Timentin, and the culture temperature was 23-25 ° C, the light was 16 / 8 h (day / night), ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



