Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea

A technology of Theileria youshii and Theileria lushii, which is applied in the field of Theileria youshii and Pyromorpha sheep, to quickly detect Theileria lushii, can solve the problems of false positives, influence on popularization and application, missed detection, etc., and achieve detection The method is simple, the detection time is less, and the detection cost is low

Inactive Publication Date: 2015-11-04
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(2) Apply some serological methods, such as complement fixation test (CFT) and indirect fluorescent antibody test (IFAT), but these methods are difficult to rule out cross-reactions between different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea
  • Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea
  • Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0017] 1. Preparation of detection membrane containing Taylor and Babesia specific oligonucleotides:

[0018] According to the determined V4 hypervariable region of the 18SrRNA gene sequence, four specific oligonucleotide probes were designed for different species of Babesia mornii, Babesia Kashgar strain, Theileria luvrii and Theileria Youkii The gene sequence of the needle is designed and named: Bm, B.spXJ, Tl and Tu. In addition, the universal probe catch-all for all piriformis and the universal probe for Taylor, and the universal probe for Babesia, Tall, Ball They are also designed and synthesized separately. All oligonucleotide probes N-(trifluoroacetamidohexyl-cyanoethyl, N, N-diisopropyl phosphoramidite[TFA])-C6 amino group ligation modification, the synthesized probe is dissolved in 0-800pmol / 150ul 500mM NaHCO 3 (pH 8.4), find the best concentration for hybridization.

[0019] Some oligonucleotides are synthesized after modification with amino groups at the 5'end. They ca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a diagnostic kit for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea, wherein the diagnostic kit comprises a Biodyne c film, and one or a plurality of specific oligonucleotide sequences in the group comprising the T luwenshuni specific oligonucleotide sequence atcttctttttgatgagttg, the T uilenbergi specific oligonucleotide sequence tgcattttccgagtgttact, the sheep Piroplasma specific oligonucleotide sequence ctgtcagaggtgaaattct, the Babesia specific oligonucleotide sequence ccttggtaatggttaataggaa, the sheep Babesia undetermined species specific oligonucleotide sequence cgggtttcgtctacttcgc, and the Babesia motasi specific oligonucleotide sequence gaatgatgccgacttaaaccct, and a pair of primers are fixed on the film.

Description

technical field [0001] The invention relates to a detection test paper for detecting Theileria lushii, Theileria yoshii and Piroplasma sheepi, and a method for rapidly detecting Theileria lushii, Theileria youshii and Piroplasma sheepi. Background technique [0002] Sheep Theileriasis is a tick-borne blood protozoan disease of sheep and goats caused by Theileria hirci, which parasitizes in epithelial cells, lymphocytes and red blood cells of cattle, sheep and other animals. It was first discovered in Egypt in 1914, and subsequently found in many countries in Africa, Europe, and Asia. my country's Theileriasis of sheep was first discovered in Qianning County, Ganzi Tibetan Autonomous Prefecture, Sichuan Province by Yang Fuguo et al. in 1957. In my country, studies have confirmed that the pathogen of sheep Theileriasis is not any of the above, but a new species, initially named T. luwenshuni and T. uilenbergi. The vectors of the worms are Qinghai blood ticks. endemic to our ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/6834C12Q2565/625
Inventor 牛庆丽刘志杰杨吉飞关贵全李有全刘爱红任巧云刘军龙殷宏罗建勋
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com