Method for obtaining lymphoma minipig disease model by knocking out p53 gene

A disease model, a technology of miniature pigs, applied in the field of medical animal disease models, can solve the problems of high cost of treatment, cell growth arrest, small size of miniature pigs, etc., and achieve the effects of easy promotion and use, high controllability, and no harm.

Active Publication Date: 2019-03-15
魏红江 +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The P53 gene is one of the most highly correlated genes found with human tumors so far, and is the focus of current tumor molecular biology research. According to relevant reports, the P53 gene is a tumor suppressor gene in the human body. Scientists have done a lot of research on the structure and function of the gene. In-depth and meticulous studies have found that more than 50% of human tumors are related to the abnormality of the P53 gene. The inactivation of the P53 gene can induce cell growth arrest, cell apoptosis, cell differentiation and abnormal DNA repair, resulting in the formation of tumors. However, the current human The treatment methods for tumors mainly rely on surgery, radiotherapy, chemotherapy, immunotherapy, and integrated traditional Chinese and Western medicine. However, they are faced with the problems of extremely low cure rate and high cost of treatment. Improving the cure rate of tumors, through the research and treatment of gene drugs has become the only way for human beings to cure tumors in the 21st century
[0004] The main physiological structure, biochemical indicators, and metabolic characteristics of pigs are very similar to those of humans. Miniature pigs are small in size, which is more convenient for operation and management during the experiment. Compared with disease models established by monkeys and other animals, they reproduce faster and cost less. It has unique advantages and application value in the research of life sciences, and the method of obtaining lymphoma minipig disease model by knocking out P53 gene has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining lymphoma minipig disease model by knocking out p53 gene
  • Method for obtaining lymphoma minipig disease model by knocking out p53 gene
  • Method for obtaining lymphoma minipig disease model by knocking out p53 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] The specific steps of the method for obtaining the lymphoma minipig disease model by knocking out the P53 gene are as follows:

[0076] The first step, the design, assembly and extracellular activity detection of P53 gene knockout TALEN plasmid pair

[0077] 1) Design the TALEN target in the fourth exon region according to the porcine P53 gene sequence on NCBI;

[0078] 2) Assemble the TALEN plasmids pCAG-pP53-L and pCAG-pP53-R, for the left TALEN recognition sequence: TCTGGAACAGCCAAGT, the RVD sequence is as follows: NG HD NG NN NN NI NI HD NI NN HD HD NI NI NN NG; for the right TALEN recognition Sequence: CCCTCAAGGCCACTGAC, the RVD sequence is as follows: HD HD HD NG HD NI NI NNNN HD HD NI HD NG NN NI HD, respectively assembled into plasmids pCAG-pP53-L and pCAG-pP53-R according to the left and right RVD sequences;

[0079] 3) Detection of extracellular activity of TALEN plasmid pair, a terminator is in the center of the coding region of luciferase, luciferase has no...

Embodiment 2

[0102] The specific steps of the method for obtaining the lymphoma minipig disease model by knocking out the P53 gene are as follows:

[0103] The first step, the design, assembly and extracellular activity detection of P53 gene knockout TALEN plasmid pair

[0104] 1) According to the porcine P53 gene sequence on NCBI, design the TALEN target in the fourth exon region. The target sequence is:

[0105] TCTGGAACAGCCAAGTCTGTAACCTGCACGGTCAGTGGCCTTGAGGG;

[0106] 2) Assemble the TALEN plasmids pCAG-pP53-L and pCAG-pP53-R, for the left TALEN recognition sequence: TCTGGAACAGCCAAGT, the RVD sequence is as follows: NG HD NG NN NN NI NI HD NI NN HD HD NI NI NN NG; for the right TALEN recognition Sequence: CCCTCAAGGCCACTGAC, the RVD sequence is as follows: HD HD HD NG HD NI NI NNNN HD HD NI HD NG NN NI HD, respectively assembled into plasmids pCAG-pP53-L and pCAG-pP53-R according to the left and right RVD sequences;

[0107] 3) Detection of extracellular activity of TALEN plasmid pair,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for obtaining a lymphoma minipig disease model by knocking out P53 genes, and belongs to the field of medical animal disease models. The method mainly comprises the steps that TALEN target spots of the P53 genes are designed, P53 gene knockout TALEN plasmid pCAG-pP53-L and pCAG-pP53-R of the P53 genes are assembled, TALEN plasmid is transfected and screened to obtain a P53 gene knockout positive cell line, reconstructed embryos are constructed based on the somatic cell nuclear transplantation technology and transplanted into the body of a surrogate sow to continue to develop, and a piglet with the P53 genes knocked out is obtained; the function of the P53 genes is verified by detecting the expression level of RNA and protein of the P53 genes in tissue of the cloned piglet and downstream related genes, and lymphoma in the tissue of the piglet is identified through histopathology and an immunohistochemical method. The built lymphoma disease model has great significance in research and development of occurring, forming and medicine of human lymphoma, and the reliable model is provided for research and treatment of human lymphoma diseases.

Description

technical field [0001] The invention relates to a method for obtaining a lymphoma minipig disease model by knocking out the P53 gene, and belongs to the field of medical animal disease models. Background technique [0002] Lymphoma originates from lymph nodes and lymphoid tissues, and its occurrence is related to the malignant transformation of immune cells produced by the proliferation and differentiation of lymphocytes in the process of immune response. It is a malignant tumor in the blood system. According to reports, the incidence of human lymphoma is increasing year by year. Males are 1.39 / 100,000, females are 0.84 / 100,000. The incidence rate in Europe, America and Japan is significantly higher than that in China, and the incidence rate in cities is much higher than that in rural areas. It is more common in young adults aged 20 to 40. Once It is very difficult to cure the disease, which endangers human life and health to a large extent. [0003] The P53 gene is one of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/85C12N5/073C12N15/873A61D19/04A01K67/027
Inventor赵红业魏红江申友锋李鸿辉赵恒角德灵
Owner魏红江