An RNA-Seq Description Method Fused with Local and Global Features
A technology of global features and local features, applied in RNA sequence pseudonucleotide composition and traditional RNA sequence analysis, in the field of bioinformatics, it can solve the problems of difficulty in determining and describing the starting point of transformation, and difficulty in global characteristics of RNA sequences.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0055] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0056] Using the present invention to fuse a new RNA sequence description method that combines local and global features, the specific steps are as follows:
[0057] (1) Based on the physical and chemical properties of nucleotide duplexes, the physical and chemical matrix (Physicochemical Matrix, PCM) of RNA sequences is constructed. PCM is a 10×(L-1) matrix, where L is the sequence length, and 10 means that 10 Physicochemical properties of a nucleotide duplex
[0058] For example given an RNA sequence of length 51:
[0059] >example
[0060] CAAAGGUGACCCACUUCGUUCAUGGACGUUCCCUGAAAUCAGGGACACUAU
[0061] Based on the ten ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



