Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An RNA-Seq Description Method Fused with Local and Global Features

A technology of global features and local features, applied in RNA sequence pseudonucleotide composition and traditional RNA sequence analysis, in the field of bioinformatics, it can solve the problems of difficulty in determining and describing the starting point of transformation, and difficulty in global characteristics of RNA sequences.

Active Publication Date: 2018-03-06
JINGDEZHEN CERAMIC INSTITUTE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The above-mentioned methods are all based on the composition of nucleotides or the physical and chemical properties of nucleotides. It is difficult to determine the starting point of the conversion of RNA into amino acid sequences. Although doublets and triplets contain local information, the global The characteristics are still difficult to describe by doublets and triplets. Since structural information is very effective in predicting RNA-related predictions, a new RNA sequence that fuses nucleotide structural properties and nucleotide position information in the sequence is designed It is necessary to describe the method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An RNA-Seq Description Method Fused with Local and Global Features
  • An RNA-Seq Description Method Fused with Local and Global Features
  • An RNA-Seq Description Method Fused with Local and Global Features

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0055] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0056] Using the present invention to fuse a new RNA sequence description method that combines local and global features, the specific steps are as follows:

[0057] (1) Based on the physical and chemical properties of nucleotide duplexes, the physical and chemical matrix (Physicochemical Matrix, PCM) of RNA sequences is constructed. PCM is a 10×(L-1) matrix, where L is the sequence length, and 10 means that 10 Physicochemical properties of a nucleotide duplex

[0058] For example given an RNA sequence of length 51:

[0059] >example

[0060] CAAAGGUGACCCACUUCGUUCAUGGACGUUCCCUGAAAUCAGGGACACUAU

[0061] Based on the ten ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an RNA sequence description method that combines local and global features, constructs an RNA sequence physicochemical matrix PCM by combining nucleotide duplex structure information and other physical and chemical properties, and the matrix contains RNA sequence structure information and sequence order information. By establishing a gray model for each row of data in the matrix and calculating its autocorrelation factor and cross-correlation factor between rows to obtain the local information of the sequence, convert the PCM into a two-dimensional image, and calculate the geometric distance of the image to obtain the global sequence information. Combining the obtained factors describing sequence local information and global information, a discrete vector description model of RNA sequence is obtained. The method is used in the prediction of RNA attribute types and RNA modification sites, can significantly improve the prediction success rate of related predictors, and has broad application prospects.

Description

technical field [0001] The invention relates to the fields of bioinformatics, RNA sequence pseudonucleotide components and traditional RNA sequence analysis technology, in particular to an RNA sequence description method that combines local and global features. Background technique [0002] With the completion of the sequencing of the human genome, bioinformatics has entered a new stage of development—the post-genome era. The hundreds of millions of genome RNA sequences produced by the Genome Project, RNA sequences are the source of genetic information, how to find out how life originated, how it evolved, how these genes make living organisms active, etc. The answers to a series of questions are the hotspots of current research. As biochemical experiments are time-consuming and laborious, bioinformatics has been greatly developed as a supplement to biological experiments. More and more scholars have explored models for predicting the properties, modification attributes, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G06F19/18
Inventor 肖绚刘子
Owner JINGDEZHEN CERAMIC INSTITUTE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products