A kind of α-amylase and its coding gene and application

A technology of amylase and gene, applied in the field of α-amylase and its coding gene and application, can solve the problem that α-amylase does not meet the requirements of industrial application, and achieve good industrial application prospects, high optimum reaction temperature, thermal good stability effect

Active Publication Date: 2018-10-09
EAST CHINA UNIV OF SCI & TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a kind of α-amylase and its coding gene and application, thus solve the defect that α-amylase in the prior art is less in line with industrial application requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of α-amylase and its coding gene and application
  • A kind of α-amylase and its coding gene and application
  • A kind of α-amylase and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The amplification of embodiment 1α-amylase gene

[0033] 1.1 Strains and their cultivation

[0034] The Antarctic low-temperature bacterium Geomycespannorum (bacteria identification NCBI accession number: JF20026, which has been deposited in CCTCC, number AF2014016) was donated from the cooperation project of the Faculty of Biological Sciences, University of Malaysia.

[0035] Wash G. pannorum spores from the 10-day-cultivated PDA slant with sterile water, inoculate liquid medium, and culture at 20°C for 7 days to collect mycelia for genome extraction: inoculate milk powder solid medium with a toothpick, and culture at 20°C Mycelia were collected after 5 days for total RNA extraction.

[0036] 1.2 Genome Extraction

[0037] Follow the instructions of the Omega Fungal Genome Extraction Kit.

[0038] 1.3 Total RNA extraction

[0039] Follow the instructions of the Takara RNA extraction kit.

[0040] 1.4 cDNA first-strand synthesis

[0041] Using the extracted total ...

Embodiment 2

[0068] Embodiment 2 Contains the construction of the Aspergillus oryzae recombinant expression vector of α-amylase gene and its transformation

[0069] 2.1 Primer design

[0070] SKA1f: 5' CTAGCTAGCTAG ATGTTTTTCAACTGCCCTGC 3'

[0071] SKA1r: 5' TCCCCCGGGGGA TCAAGGGCAATAGCTGCCCT 3'

[0072] 2.2 Construction of recombinant expression vector

[0073] Use the pSKNHG with the open reading frame of the α-amylase gene as a template, and use the primers shown in 2.1 to perform PCR amplification; double-digest the PCR product with NheI and SmaI, and then express it with Aspergillus oryzae that has also been double-digested with NheI and SmaI The vector pSKNHG was ligated and screened to obtain a recombinant plasmid (pSKNHGA1).

[0074] 2.3 Preparation of Aspergillus oryzae Competent Cells

[0075] Aspergillus oryzae slant spores were washed with sterile water, inserted into liquid medium, and cultured overnight.

[0076] When a large number of tiny mycelia appear in the medium, st...

Embodiment 3

[0085] Induced expression and purification of embodiment 3 Aspergillus oryzae recombinant bacteria

[0086] 3.1 Pick a single clone of the recombinant bacteria on the MM plate described in 2.5, inoculate the dextrin-induced liquid medium, and culture at 20°C and 200 rpm for 3 to 5 days.

[0087] 3.2 Collect the supernatant by suction filtration through the membrane, measure the enzyme activity, determine the protein concentration, and conduct protein electrophoresis.

[0088] 3.3 The collected supernatant was first loaded onto a Ni-NTA affinity column with a column volume of 1 mL with 10 mL of NPI solution containing 10 mM imidazole at a rate of 1.0 mL / min. Then use NPI-enzyme solution, NPI solutions containing 20mM, 50mM, and 200mM to elute the affinity column in turn, measure the enzyme activity of the eluate and perform SDS-PAGE electrophoresis to determine the optimal purification conditions and obtain pure GpA1 protein ,Such as figure 1 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an alpha-amylase and an encoding gene thereof and application. The alpha-amylase is a protein in (a) or (b) as follows: (a) the protein consists of an amino acid residue sequence as shown in SEQ ID NO: 3; (b) the protein is formed by enabling the amino acid residue sequence as shown in SEQ ID NO: 3 to be subjected to substitution and / or deletion of one or more amino acid residues and / or added with functions of the alpha-amylase and derived from (a). By a gene engineering technology, an alpha-amylase gene is obtained by amplification of a south pole low temperature germ Geomycespannorum, and is transferred into aspergillus oryzae to successfully realize heterologous expression. The alpha-amylase has higher optimal reaction temperature, is good in thermal stability and has a better industrial application prospect.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to an α-amylase, its coding gene and application. Background technique [0002] α-amylase (1,4-α-D-glucan-glucanhydrolase, EC3.2.1.1) is an endo-amylase. It widely exists in animals, plants, and microorganisms, and is an industrial enzyme that has a wide range of applications in food, wine, beverage, pharmaceutical and other industries. Of the 120 α-amylases that have been isolated and identified, the α-amylases derived from microorganisms account for the majority in terms of quantity. Microorganisms that can produce α-amylase include: Bacillus, Thermomonospor, Acinetobacter, Pseudomonas, Streptomyces, Aspergillus, Penicillus, etc. The α-amylases widely used in industry are mainly derived from Bacillus subtilis, Bacillus licheniformis, Aspergillus niger and Aspergillus oryzae. [0003] Although the industrial application of α-amylase and microbial α-amylase have been studi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/30C12N15/56C12N15/80C12N1/15C12R1/69
CPCC12N9/242C12Y302/01001
Inventor魏东芝高蓓贺磊张鲁嘉
OwnerEAST CHINA UNIV OF SCI & TECH