Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Functional Molecular Marker of Maize Germination Potential Gene zmglp and Its Application

A technology of functional molecules and germination potential, applied in the field of genetic engineering, can solve problems such as differences in germination rate and achieve the effect of improving efficiency

Active Publication Date: 2018-08-24
HENAN AGRICULTURAL UNIVERSITY
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although the germination rate of seeds is the result of the joint action of environmental and genetic factors, its own genetic characteristics are the main reason for the differences in germination rates among different varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Functional Molecular Marker of Maize Germination Potential Gene zmglp and Its Application
  • Functional Molecular Marker of Maize Germination Potential Gene zmglp and Its Application
  • Functional Molecular Marker of Maize Germination Potential Gene zmglp and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Development of functional molecular markers of corn seed germination potential gene ZmGLP

[0052] (1) Sequence structure analysis of maize ZmGLP gene

[0053] The inventors analyzed and studied the differentially expressed proteins in the germination process of Nongda 108, Zhengdan 958, Xianyu 335, Yuyu 22, Jundan 20 and Jundan 18 and their corresponding parental seeds. On the above, the gi|195606798 protein that affects the germination characteristics of seeds was obtained, the reference sequence of the ZmGLP gene was extracted, and multiple pairs of amplification and sequencing primers were designed to amplify the ZmGLP gene of 40 maize inbred lines. Two pairs of primers including UTR, exon, intron and 3'UTR (cupinF2: CGTAGCACCAGAAAAGAAATGTA / cupinR1: CACAGGTAGGCGGTAGCAGC, cupinF6: GGGGAAGCGAAGGTTGGGTAT / cupinR7: ACAAACGGTCACTGCGGGAC) were used to amplify and sequence the ZmGLP gene sequences of other inbred lines .

[0054] The promoter region of the ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a functional molecular marker for a corn germination potential gene ZmGLP. The sequences of PCR primers of the functional molecular marker are as followed: IDF:TATTCCCGAACGGGTCCC and IDR:CGAGGTGGTGAAGCCGAAGAA; the sequences of internal reference primers of the functional molecular marker are as followed: CF:GGGGAAGCGAAGGTTGGGTAT and CR:CGTTGAAGGCACGGGTAAGC. The functional molecular marker for the corn germination potential gene ZmGLP does not depend on molecular genetic mapping, the efficiency of molecular marker-assisted selection can be greatly improved through the functional marker, the functional molecular marker can be directly applied to practice, and a technical support is supplied to selection breeding of good inbred lines or hybrids with the high germination rate through a molecular marker-assisted selection method.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a functional molecular marker of a maize germination potential gene ZmGLP and its application in breeding. Background technique [0002] In corn production input, seed is the most basic and effective input, and also the most special means of production, which directly affects the economic interests of producers, operators and users. Among many indicators to measure seed quality, germination rate is the most direct and effective evaluation standard, which is of great significance for seed purchase, storage, transportation, etc., and is also the basis for determining the sowing amount in the field. Almost every year in my country's agricultural production, there are cases of corn production reduction due to low seed germination rate. In recent years, some large multinational seed companies such as Pioneer and Syngenta have successively entered the Chinese market. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 付志远汤继华丁冬李卫华李浩川薛亚东郭占勇
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com