Molecular marker and application of agpl1 micro-controlling gene of rice amylose content

A technology of amylose content and molecular markers, applied in the field of agricultural biotechnology engineering, can solve the problems of poor accuracy and achieve the effect of overcoming the long time period

Active Publication Date: 2019-11-19
CHINA NAT RICE RES INST
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the effects of one cause and multiple effects, multiple causes and one effect, regulatory genes, and modified genes among genes, there are often large differences between individual phenotypes and genotypes, so the accuracy of individual selection through field phenotypic traits is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker and application of agpl1 micro-controlling gene of rice amylose content
  • Molecular marker and application of agpl1 micro-controlling gene of rice amylose content
  • Molecular marker and application of agpl1 micro-controlling gene of rice amylose content

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1. Using the Indel marker AGPL1-m to identify polymorphisms in the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0064] The specific method is: select rice materials Nipponbare and Teqing from the germplasm resource bank of the China Rice Research Institute, and use Nipponbare and Teqing to obtain their F1, and use the primer AGPL1-m to identify their polymorphism ( figure 1 ).

[0065] 1. DNA extraction

[0066] 1) Prepare DNA extraction buffer:

[0067] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA; 2M NaCl; 0.055MCTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to prepare DNA extraction buffer solution; the final concentration of sodium bisulfite i...

Embodiment 2

[0087] Example 2. Using the Indel molecular marker AGPL1-m to identify sequence differences between the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0088] The specific method is: use the Indel molecular marker AGPL1-m to perform PCR amplification on the genomic DNA of Nipponbare and Teqing, entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare the differences in their sequences ( figure 2 ).

[0089] 1. DNA extraction

[0090] 1) Prepare DNA extraction buffer:

[0091] With embodiment 1.

[0092] 2), the paddy rice blade of above-mentioned Nipponbare and special green is carried out as follows respectively:

[0093] With embodiment 1.

[0094] 3) PCR amplification

[0095] With embodiment 1.

[0096] 4) Recovery of PCR products

[0097] The recovery of PCR products was carried out by using the PCR product recovery kit (spin column type, catalog number: DP1403) develo...

Embodiment 3

[0099] Example 3. Using the Indel marker AGPL1-m to carry out assisted selection breeding for low amylose content

[0100] The specific method is: the gene donor parent Nipponbare with low amylose content is crossed, backcrossed and self-crossed with Teqing, an indica rice variety with high amylose content, and the segregation population is selected by the assisted selection of the resulting offspring combined with the molecular marker AGPL1-m The individual plants with the same middle zone type and the Japanese sunny zone type are used for breeding and improvement.

[0101] 1. DNA extraction

[0102] 1) Prepare DNA extraction buffer:

[0103] With embodiment 1.

[0104] 2), above-mentioned Nipponbare, Teqing, and the rice blades of the gained offspring are respectively processed as follows:

[0105] With embodiment 1.

[0106] 2. Indel marker detection

[0107] 1), PCR amplification

[0108] With embodiment 1.

[0109] 2), electrophoresis detection

[0110] With embod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker AGPL1-m of a rice amylose content micro-control gene AGPL1. Rice is used as a species, a molecular marker primer is selected from the following primer pairs, wherein a nucleotide sequence is 5'->3', the forward AGPL1-m is TCTGCGAGCCTTGTTATCCA, and the reverse AGPL1-m is TGCCAGGGAGAAATGGAGAA. The molecular marker AGPL1-m is used for identification of paddy rice amylose content and / or assistant selective breeding their offspring.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker AGPL1-m related to rice amylose content regulation gene AGPL1 and an obtaining method thereof. Background technique [0002] High yield and high quality have always been the long-term goal of rice breeding. After long-term efforts, especially the use of hybrid rice technology, my country has achieved universally recognized achievements in rice production. However, in the past, how to solve people's food and clothing problems has always been the first priority, so the focus of rice breeding work is mostly concentrated on the cultivation of new high-yield varieties of rice, resulting in a serious lag in the breeding of high-quality rice, especially some high-yield hybrid rice General deviations in quality. [0003] Another main reason for the slow progress in rice quality improvement is the complexity of rice quality inheritance and the limit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895
CPCC12Q1/6895C12Q2600/156
Inventor代丽萍曾大力钱前胡江张光恒朱丽董国军郭龙彪高振宇陈光
OwnerCHINA NAT RICE RES INST