A functional marker of wheat phytoene synthase gene psy-e2 and its application

A technology of psy-e2, phytoene, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of accelerated breeding process, complex genome, low efficiency of genetic improvement, etc. , to achieve the effect of accelerating the breeding process and improving the efficiency

Active Publication Date: 2021-07-20
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Wheat is an allohexaploid with a complex genome. The efficiency of genetic improvement of agronomic traits simply by relying on traditional methods is low and cannot meet the current breeding needs. The use of functional gene markers for assisted selection can improve the efficiency of wheat breeding and accelerate the breeding process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A functional marker of wheat phytoene synthase gene psy-e2 and its application
  • A functional marker of wheat phytoene synthase gene psy-e2 and its application
  • A functional marker of wheat phytoene synthase gene psy-e2 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Production psy-e2 Functional Marker Primers

[0026] According to the wheat genome database psy Primers were designed for the conserved segment of the gene reference sequence, and the genomic DNA of the wheat sample with excellent resistance was extracted. After PCR amplification and sequencing analysis, the obtained psy-e2 Gene sequence from parent 7el 2 . The psy genes derived from the seventh homology group are 7A, 7B, 7D and psy-e2 Sequence (SEQ ID NO.3-6) alignment, design identification psy-e2 Gene-specific primers ( figure 1 ).

Embodiment 2

[0027] Example 2 Wheat phytoene synthase gene of the present invention psy-e2 feature flags.

[0028] Wheat phytoene synthase gene of the present invention psy-e2 Functional markers, where primers include:

[0029] Primer sequence PSY-F: TGGCTTCAATAGGATCAAAGTA (SEQ ID NO.1);

[0030] Primer sequence PSY-R: CCAGCTCGTCTGTCCTCCTG (SEQ ID NO. 2).

[0031] A kind of based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:

[0032] (1) Buffer S method was used to extract the genomic DNA of the sample;

[0033] Described adopt Buffer S method to extract the DNA of wheat sample, concrete steps are as follows:

[0034] Weigh 0.05-0.10g of wheat leaves, freeze the leaves with liquid nitrogen and quickly grind them into powder, put them into a 1.5mL centrifuge tube, add 500μL of Buffer S extraction buffer preheated at 60°C, and the Buffer S extraction buffer is Liter contains 100mmol / L Tris-HCl (p...

Embodiment 3

[0040] Embodiment 3 Wheat phytoene synthase gene of the present invention psy-e2 Application of feature flags

[0041] Wheat phytoene synthase gene as described in Example 2 psy-e2 Functionally marked method to operate.

[0042] The sample population is parental SDAU2003 and Chinese spring ph1b Constructed F 4 Progeny samples.

[0043] A kind of wheat based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:

[0044] (1) Collect samples;

[0045] (2) Buffer S method was used to extract the genomic DNA of the sample;

[0046] (3) Use the extracted DNA as a template for PCR amplification;

[0047] (4) The PCR product was detected on a non-denaturing 8% PAGE gel, and the color was developed after silver staining.

[0048] Analysis of electrophoresis results, primers PSY-F and PSY-R amplified three bands of 157bp, 183bp and 186bp, indicating that the wheat sample contained psy-e2 Gene; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a wheat phytoene synthase gene psy‑e2 The functional markers, wherein the PCR primer sequences are PSY‑F and PSY‑R. The detection steps are as follows: Buffer S method is used to extract the whole genome DNA of wheat leaves; psy‑e2 Gene function marker detection DNA was extracted for PCR amplification; PCR products were subjected to PAGE electrophoresis, and silver staining was used for color reaction to observe the results. In the present invention psy‑e2 The functional molecular marker does not depend on molecular genetic mapping, the use of this functional marker can improve the efficiency of molecular marker-assisted selection, and can be directly applied to production practice. Or hybrids provide technical support.

Description

technical field [0001] The invention belongs to the technical field of wheat molecular breeding, and in particular relates to a functional marker for identifying phytoene synthase gene psy-e2 and a method thereof. Background technique [0002] Wheat is one of the most important food crops in the world. In recent years, with the improvement of living standards, people's demand for high-quality wheat is increasing, and more and more attention has been paid to the nutrition of flour and its products. How to make steamed buns, dumplings, noodles and other traditional steamed foods both delicious and good-looking and nutritious has become one of the goals of high-quality wheat breeding. The content of yellow pigment in wheat grains is closely related to the color and nutritional quality of cooked noodles. Bright white flour products are popular in China, Europe and the United States. Yellow pigment is an important factor that causes the whiteness of flour to decrease, and redu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/6895
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 孔令让王彪李学峰
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap