Applications of ALS (acetolactate synthase) mutant type protein based on gene editing technology and ALS mutant type protein gene in plant breeding

A gene editing and mutation technology, applied in applications, plant peptides, plant products, etc., can solve problems such as heavy workload, inability to create variant types, and unsatisfactory effects, and achieve the effect of speeding up the breeding process and improving the breeding efficiency.

Active Publication Date: 2018-12-28
JIANGSU ACAD OF AGRI SCI
View PDF4 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Researchers have used gene replacement technology to successfully realize the mutation of 548 amino acids from tryptophan to leucine and 627 amino acids from serine to isoleucine, but this method is based on the reported base mutations and cannot create new ones. Variation type of
[0012] At present, if scientific and technical personnel want to obtain new rice materials or new genes that are resistant to herbicides, they need to use chemical or radiation mutagenesis, etc., which requires a lot of work and the results are not ideal, and most of the obtained herbicide-resistant ALS proteins have been reported. Variation type of
[0013] However, using conventional chemical mutagenesis and conventional transgenic breeding, the breeding period should be at least 4-6 years. At present, there is no relevant report on the use of gene editing technology to conduct site-directed mutation of the ALS gene of rice varieties to create new herbicide-resistant new alleles. genetic research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of ALS (acetolactate synthase) mutant type protein based on gene editing technology and ALS mutant type protein gene in plant breeding
  • Applications of ALS (acetolactate synthase) mutant type protein based on gene editing technology and ALS mutant type protein gene in plant breeding
  • Applications of ALS (acetolactate synthase) mutant type protein based on gene editing technology and ALS mutant type protein gene in plant breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1: Process of obtaining rice mutants resistant to imidazolinone herbicides (imazethapyr)

[0068] 1. Cloning and target site design of Nanjing 9108 ALS gene

[0069] Referring to the CTAB method of Murray et al., the genomic DNA of Nanjing 9108 was extracted (Murray M G, et al., Nucleic Acids Research, 1980, 8(19):4321-4326). Genomic DNA was amplified by PCR with primers ALS5-F: TCGCCCAAACCCAGAAACCC, ALS5-R: CTCTTTATGGGTCATTCAGGTC, and the amplified products were sent to Yingwei Jieji (Shanghai) Trading Co., Ltd. for sequencing. The sequencing results were compared with the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database for Blast analysis, and it was found that the sequence of the ALS coding region of Nanjing 9108 was the same as that of the reference genome rice Nipponbare.

[0070] According to the ALS gene sequence of Nanjing 9108, the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ) was used to predict, and 5'-TCCTTGAATGCGCCCCCACT-3' wa...

Embodiment 2

[0104] Embodiment 2: ALS gene cloning of rice mutant resistant to imidazolinone herbicides

[0105] To the T of the A51 strain of the above-mentioned embodiment 1 1Generation 18 individual plants were numbered, their leaves were taken, and genomic DNA was extracted, and PCR amplification was performed with specific primers ALS-F5'-TCGCCCAAACCCAGAAACCC-3' and ALS-R 5'-CTCTTTATGGGTCATTCAGGTC-3' for the full length of the ALS gene . The amplified products were sent to Yingwei Jieji (Shanghai) Trading Co., Ltd. for sequencing. Comparing the sequencing results with the wild-type ALS gene of Nanjing 9108, it was found that the single plants numbered 1-9, 11, 14, 16 and 17 had a homozygous mutation from G to T at the 1882nd base; Single plants of 13 and 15 had biallelic variation, one of the alleles was the mutation from G to T at the 1882nd base, and the other allele was the deletion of the G base at the 1882nd position; no 1882nd base was obtained Homozygous single plants with b...

Embodiment 3

[0108] Example 3 T-DNA elimination of rice mutants resistant to imidazolinone herbicides

[0109] The binary T-DNA carrier for direct editing ALS gene constructed by the present invention, the T-DNA involved in the present invention mainly includes the hygromycin phosphotransferase HPT gene and the Cas9 nuclease gene, because the hygromycin phosphotransferase HPT gene and the The main function of the Cas9 gene is to complete the site-directed mutation of the target gene, and these two genes are foreign genes relative to the rice genome. On the one hand, hygromycin is an antibiotic and needs to be deleted. If the Cas9 gene is retained, it may lead to continued editing and other functions; on the other hand, the random insertion of T-DNA may also lead to unexpected gene mutations, so it needs to be cleared after it completes the gene editing task. Through Agrobacterium-mediated transformation of Nanjing japonica 9108, during the transgenic process, the T-DNA sequence will be ran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice ALS (acetolactate synthase) mutant type protein, a mutant type gene and applications of the rice ALS mutant type protein and the mutant type gene. The amino acid sequence of the ALS mutant type protein has following mutation: the 628-poisiton amino acid corresponding to the amino acid sequence of rice ALS has the mutation. The invention further discloses a breeding method of creating herbicide-resistant rice by gene editing. The CRISPR / Cas9 gene editing technology is used for editing the ALS gene for the first time, a T-DNA-knockout new material with the stably inherited herbicide resistant characteristic can be obtained in the T2 generation through offspring screening, and basic agronomic traits of the new material have no obvious change. Compared with breeding based on chemical mutagenesis, hybrid transform breeding and the like, the orderly improved molecular breeding technology based on gene editing has the advantages of being rapid, accurate, efficient and the like, and by means of combination with gene function marked genotype selection, breeding efficiency can be greatly increased and breeding progress is substantially accelerated.

Description

technical field [0001] The invention belongs to the fields of crop genetic breeding and crop herbicide-resistant new resource innovation, and specifically relates to the application of ALS mutant protein and gene thereof based on gene editing technology in plant breeding. Background technique [0002] With the development of my country's new urbanization and modern agriculture, the light and simple cultivation of rice production is becoming more and more popular, and methods such as machine transplanting and live broadcast have become a development trend. However, weeds and weedy rice are easy to breed in direct-directed rice fields, which seriously affect rice growth, yield and rice quality. The cost of manual and mechanical weeding is extremely high, which restricts the development of rice production in the direction of high yield, high efficiency and low cost, and is not conducive to the development of modern agriculture. Spraying herbicides is an effective means to cont...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1022C12N15/8274C12Y202/01006C12Q1/6895C12Q2600/13C12N9/10C07K14/415C12N15/8213C12N2310/20C12N2800/80
Inventor杨杰王芳权
OwnerJIANGSU ACAD OF AGRI SCI