Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GBSSI mutant protein based on gene editing technology and application thereof in plant breeding

A gene editing and mutation technology, which can be applied in applications, plant products, genetic engineering, etc., can solve problems such as laboriousness, affecting Wx gene activity, and many uncertain factors

Pending Publication Date: 2021-05-07
SHANGHAI NORMAL UNIVERSITY
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These alleles generally have one or several base differences in sequence, and these differences will affect the expression of Wx gene and the activity of GBSS, resulting in the difference of amylose content and rice quality
[0004] These excellent traits can also be transferred to local varieties through traditional breeding methods, but this method is time-consuming, laborious, and has many uncertain factors, making it difficult to improve local varieties in a short period of time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GBSSI mutant protein based on gene editing technology and application thereof in plant breeding
  • GBSSI mutant protein based on gene editing technology and application thereof in plant breeding
  • GBSSI mutant protein based on gene editing technology and application thereof in plant breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: The process of obtaining the rice mutant waxy-m with about 5% amylose content

[0040] 1. Selection of CRISPR / Cas9 modified targets

[0041] Scanning the whole genome sequence of Waxy, the Waxy gene has 13 exons in total. According to existing research, it is known that Waxy single-base mutation sites are mainly concentrated in exons 4-6. Based on this, we limited the selection of mutation sites to On the 4th exon, the 4th exon was screened with the help of CRISPR-GE (http: / / skl.scau.edu.cn) and CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR) websites The targeting sequence on the exon: AAGACCGGTGAGAAGATCTA (SEQ ID NO.5), located at bases 10-29 in the 4th exon.

[0042] 2. CRISPR / Cas9 vector construction

[0043] The following oligonucleotides were synthesized for this targeting sequence: sgRNA-Waxy-F: 5'-TGTGTGAGACCGGTGAGAAGATCTA-3' (SEQ ID NO.6); sgRNA-Waxy-R: 5'-AAACTAGATCTTCTCACCGGTCTCA-3' (SEQ ID NO.7); Dissolve the synthesized primers sgRNA-Waxy-F and sg...

Embodiment 2

[0046] Example 2: Cloning of the rice mutant Waxy-m gene with an amylose content of about 5%

[0047] The leaves of the T1 generation individual plants of the homozygous mutant plants in the above-mentioned Example 1 were taken respectively, and genomic DNA was extracted, and PCR amplification was performed with specific primers Waxy-F and Waxy-R for the full length of the Waxy gene. Amplified products were sequenced. The sequencing results were compared with the Xiushui 134 wild-type Waxy gene (the nucleic acid sequence is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4), and it was found that the 849th and 850th positions C of the gene were mutated to T. The fusion mutation is the same as that of the T0 generation plants. Further analysis shows that the mutation of this site of the Waxy gene leads to the mutation of the GBSSI protein sequence and the 178th amino acid of Xiushui 134GBSSI protein from threonine to isoleucine, such as image 3 shown. ...

Embodiment 3

[0050] Embodiment 3 Removes the acquisition of the stable mutant plant of T-DNA carrier

[0051] The vector for directed editing of the Waxy gene constructed by the present invention contains a T-DNA vector. The T-DNA involved in the present invention mainly includes the selection marker HPT gene and the Cas9 element. Due to the main functions of the hygromycin phosphotransferase HPT gene and the Cas9 element It is used for the screening of transformed positive plants and the completion of site-directed mutation of the target gene, and these two genes are foreign genes relative to the rice genome, and HPT is an antibiotic selection marker that needs to be eliminated. If the Cas9 element is retained in the plant It is possible to continue editing the mutation site to generate other Waxy alleles, and the random insertion of T-DNA may also cause unexpected gene mutations, so it needs to be cleared after the gene editing task is completed. Through Agrobacterium-mediated transforma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice amylose synthase GBSSI mutant protein, a coding gene thereof and an application of the GBSSI mutant protein in breeding. An amino acid sequence of the GBSSI mutant protein has the following mutations that the 178th amino acid of the corresponding rice GBSSI amino acid sequence is mutated. The invention also discloses a breeding method for creating rice with amylose content of about 5% by gene editing. A CRISPR / Cas9 gene editing technology is utilized to carry out site-directed mutagenesis on a Waxy gene, a new material without a Cas9 element can be obtained in a T1 generation through offspring screening, and basic agronomic characters of the new material are not obviously changed compared with those of a wild type. Compared with traditional chemical mutation breeding, cross breeding and other means, a gene editing oriented improved molecular breeding technology has the advantages of high efficiency, accuracy and the like, the breeding efficiency is greatly improved, and the breeding process is accelerated.

Description

technical field [0001] The invention relates to the fields of rice genetic breeding and waxy quality improvement, in particular, the invention relates to a GBSSI mutant protein based on gene editing technology and its application in plant breeding. Background technique [0002] Rice is an important food crop. With the improvement of people's living standards, the demand for high-quality rice varieties has further increased. The amylose content of rice affects the waxiness of rice, which in turn affects the variety and taste of rice. The gelatinization temperature of high-amylose rice is higher, the gelatinous consistency is reduced, and the viscosity, gloss and softness of cooked rice are relatively poor; the rice with low-amylose content has crystal grains and a soft taste after cooking, so Much favored by people. Therefore, improving rice quality by reducing the amylose content in rice has always been the goal of breeders. [0003] Amylose in rice is mainly catalyzed by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/84C12N15/55A01H5/10A01H6/46
CPCC12N9/1051C12N15/8218C12N15/8245C12N15/8205C12N9/22C12Y204/01021
Inventor 张辉汪冲魏闯贾萌
Owner SHANGHAI NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com