Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection primer and probe system for gallibacterium and detection method of gallibacterium

A detection method and detection primer technology, applied in biochemical equipment and methods, methods based on microorganisms, measurement/testing of microorganisms, etc., to achieve good repeatability, high specificity, and good sensitivity

Inactive Publication Date: 2016-06-22
HENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Up to now, there is no report on the detection method of fluorescent quantitative PCR with the probe method of Gallibacterium coliformis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer and probe system for gallibacterium and detection method of gallibacterium
  • Detection primer and probe system for gallibacterium and detection method of gallibacterium
  • Detection primer and probe system for gallibacterium and detection method of gallibacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Primer design and synthesis

[0037] The fluorescent quantitative PCR primers and probes were designed and synthesized according to the gtxA toxin gene sequence published by GenBank. The length of the amplified fragment was 150, and the synthesis was entrusted to Shanghai Sangon Bioengineering Co., Ltd. The sequences of primers and probes are shown in Table 1 and SEQ ID NO: 1-3:

[0038] Table 1 Primer and Probe Sequences

[0039] .

[0040] 2. Sample DNA Preparation

[0041] (1) Preparation of bacterial DNA

[0042] Inoculate the bacteria in LB medium containing 10% calf serum, incubate at 37°C for 18 hours, take 1 mL of the cultured bacterial solution and add it to a 1.5 mL centrifuge tube, centrifuge at 10,000 r / min for 5 min, discard the supernatant, add 600 μL of TE, and shake Mix well, place the bacterial solution in boiling water and boil for 10 minutes, then immediately ice-bath for 2 minutes, centrifuge at 12,000 r / min for 10 minutes, and take the sup...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of animal inspection and quarantine, and particularly relates to a detection primer and a probe system for gallibacterium. The detection primer and the probe system for the gallibacterium comprise the following sequences: Primer-F: atgggacattctatcgcaaacc, Primer-R: aacggcggtagaggcattag and Probe_IN: FAM-tgttaatacaagtagcgggaaagcggc-TAMRA. A detection method of the gallibacterium comprises the following steps of extracting the DNA (deoxyribonucleic acid) of a sample; establishing a standard curve, so as to obtain a standard curve equation; carrying out gallibacterium fluorescent quantitative PCR (Polymerase Chain Reaction) detection on the DNA of the sample. The detection primer and the probe system, which are provided by the invention, have high degrees of specificity, and are further good in sensibility; the detection method of the gallibacterium is good in repeatability, and is applicable to the quick identification and the clinical detection of the gallibacterium.

Description

technical field [0001] The invention belongs to the field of animal inspection and quarantine, and in particular relates to a detection primer and probe system and a detection method for Gallibacterium gallis, which are suitable for rapid identification and clinical detection of Gallibacterium gallis. Background technique [0002] Gallibacterium (Gallibacterium) is a genus regrouped by Christensen et al. in 2003 in Pasteurellaceae, including the original duck Pasteurella (Pasteurellaanatis), salpingitis Actinobacillus (Actinobacillus salpingitidis) and haemolytic Pasteurella ( Haemolytic Pasteurella). Gallibacterium gallis is a common bacterium in healthy chickens, but a large number of studies have shown that it is closely related to salpingitis, an important disease in laying hen farms, and has conditional pathogenicity. Artificial infection can cause salpingitis, peritonitis and diseases such as sepsis. Data show that Gallibacterium coliformis is widely prevalent in pou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/06C12N15/11C12R1/01
CPCC12Q1/689C12Q1/6851C12Q2531/113C12Q2563/107C12Q2545/113
Inventor 皇甫和平许文博孙彦婷王宏魁董青郭宏伟李云霞高文文
Owner HENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com