Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of osteopetrosis-associated transmembrane protein in the treatment or prevention of ev71 infection

A technology of osteosclerosis and transmembrane protein, which is applied in the fields of peptide/protein components, medical preparations containing active ingredients, antiviral agents, etc., which can solve the problems such as the lack of clinical trials and the lack of preventive and therapeutic effects on enteroviruses.

Inactive Publication Date: 2019-09-24
WUHAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Finally, we can prevent EV71 infection by vaccination. Current EV71 vaccine candidates mainly include live attenuated vaccines, genetically engineered vaccines, DNA vaccines, virus-like particles, and genetically modified vaccines. These vaccines have been evaluated in animal experiments. However, clinical trials have not yet been conducted
However, there is no literature report on the relationship between Ostm1 protein and viral diseases and related viruses, and there is no report on the preventive and therapeutic effects of this virus on the large-scale epidemic and relatively highly pathogenic enterovirus (EV71)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of osteopetrosis-associated transmembrane protein in the treatment or prevention of ev71 infection
  • Application of osteopetrosis-associated transmembrane protein in the treatment or prevention of ev71 infection
  • Application of osteopetrosis-associated transmembrane protein in the treatment or prevention of ev71 infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The application of a transmembrane protein associated with osteopetrosis in the preparation of a drug for preventing and / or treating EV71 infection, the steps of which are:

[0032] 1. Expression and purification of Ostm1 protein in insect baculovirus expression system:

[0033] First, the applicant used the cDNA of HepG2 cells (from the China Center for Type Culture Collection) as a template, used specific primers (sequence as follows) to amplify the target gene, and then connected it to the plasmid vector pCAGG-HA (Invitrogen) . The primer sequences are as follows:

[0034] Forward: GCGACCGAATTCATGGAGCCGGGCCCGACAGC

[0035] Reverse: CGCGCTCGAGGTTTGAATTTTCCTGAATATTGC

[0036] Then use specific primers to amplify the target gene from the above plasmid, and clone it into the pFastBacDual vector. The sequences of the primers are as follows:

[0037] Forward: CTGAATTCATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTTATGGTCGTGTACATT

[0038] TGGTCGTGTACATTTCTTACATCTATGCGATCGAGGGAAGGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an application of osteopetrosis-related transmembrane protein in a medicine for treatment or prevention of EV71 infection. The application comprises the following steps: firstly, expressing Ostml protein by an insect baculovirus expression system in an insect cell (SF9); purifying the Ostml protein by a nickel column affinity chromatography method; and finally, validating the antiviral effect of the Ostml protein in EV71-infected malignant rhabdomyosarcoma cells (RD cell). An experiment result proves that the purified Ostml protein is capable of inhibiting EV71 virus replication in mRNA level and protein level at certain concentration. The anti-EV71 virus effect of the osteopetrosis-related transmembrane protein (Ostml) is evaluated from protein purification and nucleus molecular level; a foundation is laid for further development and application. The protein is capable of directly inhibiting EV71 virus replication at proper concentration, is obvious in effect and free of a side effect on the cell, and simple and convenient to use. The medicine has the prospect that the medicine can be developed into an anti-EV71 virus effective medicine for clinical application.

Description

technical field [0001] The present invention relates to the field of antiviral drugs, and relates to a new application of an osteopetrosis associated transmembrane protein (Osteopetrosis associated transmembrane protein 1), and more specifically relates to the application of an osteopetrosis associated transmembrane protein in the treatment or prevention of EV71 infection . Background technique [0002] Human enterovirus 71 (Hu-man enterovirus) belongs to the genus Enterovirus of the family Picomaradae. The EV71 virus particle is an icosahedral symmetrical spherical structure without envelope and spikes, and its diameter is about 24-30nm. The full length of the viral genome is 7408bp, which is a single-stranded positive-sense RNA. There is only one open reading frame (ORF) in the genome, with 5' and 3' non-coding regions (UTRs) on both sides of the ORF, and at the end of the 3' end of the genome There is also a polyadenylic acid tail (poly-A) of variable length. The ORF i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K38/17A61P31/14
Inventor 吴建国邬开朗马春强潘攀刘映乐刘芳
Owner WUHAN UNIV