Method for efficient deletion of Riemerella anatipestifer gene
A duck plague Riemer's and gene technology, applied in the biological field, can solve the problems of low recombination efficiency, cumbersome steps, and long time-consuming, and achieve the effect of low cost, simple method, and high knockout efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1, the construction of recombinant fragment
[0023] 根据NCBI报道的RA ATCC11845株的RA0C_1193基因序列,具体序列如下:atgagccaaaccataaatacatcggaaagaaaagaccaaatcaaaagtgccatcatcacatttttgattagccttttggtattcttagctttgtatttttattcgtttactagagaacttccaaaggaggaagtcgtaagcacgatgctcatcaattttggagaccaaaacgagggtaacctgcctgaagaaccccaaaaccaagagggcagtctatccgccaccgaagcacctacaccaatacaagaaatacaacctacacctgtagaacctcagcccaaaaaagaagtggtaaaggagaaaattatcacagggcaaaataccaaaacaagtgctgaaaaggtggaaaaagtaacctctaaacctacaaaagaaagcacagcaaacacccaaaagaaagaaaccacgacacctaaaaaaagcagtaccactacacaaaataaaaccgtgaccaaccaaggtgatggcagaggtaacgaggctattggcaacctcatcagagggcgaggtgccaacaaaggagctcaaggaaactcccaaaacacttccggcaattcaggagacccactaggtggcgatagcaatggcgatagtaaaatcggcatagaccgaaagttaatcggatttatacctggaactatggggcgtggtggttcacagccgacccaccagtgttctgcctcaggcaccattagcatctcttatgtggtagataaagcgggcaatgtaatttcggctagacgaagtggcggtattacagacccttgtgccgtaaacacaaccatagagtgggtaaagaaatatgtaaaagcagaaagagctagcacttcttctacaggcacttacaaaatcactttctaa(SEQ ID NO.1)
[...
Embodiment 2
[0035] Embodiment 2, the preparation of recipient bacterium
[0036] Take out the RA ATCC11845 wild strain from -80°C and recover it on a blood plate. After it grows up, use an inoculation loop to pick a monoclonal colony and inoculate it into 10ml liquid GCB medium for overnight cultivation; after overnight cultivation, dilute the bacterial solution with medium to OD600=1, then add 5mM MgCl 2 Mix well and set aside.
Embodiment 3
[0037] Embodiment 3, natural transfer
[0038] Prepare two 1.5ml sterile centrifuge tubes, one as the experimental group and one as the control group, add 300μl (containing 5mM MgCl 2 ) the above bacterial solution, wherein 1 μg of the fusion fragment was added to the experimental group, and not added to the control group. Seal with sealant and incubate in a 37°C incubator for 30 minutes; take out the experimental group and control group incubated for 30 minutes, and add 700 μl of 5mM MgCl to them 2 GCB culture medium, that is, dilute to 1ml, seal with sealing glue, and incubate in a 37°C incubator for 7 hours; preparation of culture medium: 4 GCB solid medium containing erythromycin (1 μg / ml) (Erythromycin, Erm) ; Take out 100 μl of bacterial solution from the experimental group and the control group, respectively, and spread them on the erythromycin-resistant GCB solid medium with a disposable coating rod, and then place the medium in a 37°C incubator for 18 hours to form a...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com