Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit

A kit and nucleic acid technology, which is applied in the field of nucleic acid combinations and kits for detecting ALDH2 gene mutations, can solve problems such as pollution, inability to determine the position and type of SNP, expensive special instruments, etc., and achieve convenient operation, improved sensitivity and Effect of improving specificity and detection sensitivity

Inactive Publication Date: 2017-04-26
GUANGZHOU EZLIFE BIO CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it can only determine whether there is a mutation, and cannot determine the position and type of SNP. It needs to be verified by standard samples or combined with sequencing, and requires expensive special instruments and professional analysis software. This is one of the reasons why DHPLC has not been widely implemented.
In addition, the detection process needs to open the reaction tube, which is easy to cause pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit
  • Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit
  • Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] The nucleic acid combination for detecting ALDH2 gene mutation provided in this example includes a wild-type upstream primer, a downstream primer and a capture probe, and the 5' end of the downstream primer is labeled with biotin (Biotin).

[0062] The base sequence of the wild-type upstream primer is as follows:

[0063] 5'-GCTGCAGGCATACACT G -3' (SEQ ID NO.1), wherein the underlined part may correspond to the rs671 site (G) of the wild-type ALDH2 gene, which is completely complementary to the wild-type target sequence.

[0064] The base sequence of the wild-type target sequence is as follows:

[0065] 5'- GCTGCAGGCATACACTG AAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAGGGTCTGCTGGTGGCT-3'.

[0066] The base sequence of the downstream primer is as follows:

[0067] 5'-AGCCACCAGCAGACCCTC-3' (SEQ ID NO. 3).

[0068] The base sequence of the capture probe is as follows:

[0069] 5'-AAGTGAAAACTGTGAGTGTGGGACC-3' (SEQ ID NO. 4).

[0070] The probe provided in...

Embodiment 2

[0072] The nucleic acid combination for detecting ALDH2 gene mutation provided in this example includes: a mutant upstream primer, a downstream primer and a capture probe, and the 5' end of the downstream primer is labeled with biotin (Biotin).

[0073] The base sequence of the mutant upstream primer is as follows:

[0074] 5'-GCTGCAGGCATACACT A -3' (SEQ ID NO.2), wherein the underlined part may correspond to the rs671 site (A) of the mutant ALDH2 gene. It is fully complementary to the mutant target sequence.

[0075] The base sequence of the mutant target sequence is as follows:

[0076] 5'-GCTGCAGGCATACACTAAAAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAGGGTCTGCTGGTGGCT-3'.

[0077] The base sequence of the downstream primer is as follows:

[0078] 5'-AGCCACCAGCAGACCCTC-3' (SEQ ID NO. 3).

[0079] The base sequence of the capture probe is as follows:

[0080] 5'-AAGTGAAAACTGTGAGTGTGGGACC-3' (SEQ ID NO. 4).

[0081] The probe provided in this example can be us...

Embodiment 3

[0083] The nucleic acid combination for detecting ALDH2 gene mutation provided in this example includes: a wild-type upstream primer, a mutant upstream primer, a downstream primer and a capture probe, and the 5' end of the downstream primer is labeled with biotin (Biotin).

[0084] The base sequence of the wild-type upstream primer is as follows:

[0085] 5'-GCTGCAGGCATACACT G -3' (SEQ ID NO.1), wherein the underlined part corresponds to the rs671 site (G) of the wild-type ALDH2 gene.

[0086] The base sequence of the mutant upstream primer is as follows:

[0087] 5'-GCTGCAGGCATACACT A -3' (SEQ ID NO.2), wherein the underlined part may correspond to the rs671 site (A) of the mutant ALDH2 gene.

[0088] The base sequence of the downstream primer is as follows:

[0089] 5'-AGCCACCAGCAGACCCTC-3' (SEQ ID NO. 3).

[0090] The base sequence of the capture probe is as follows:

[0091] 5'-AAGTGAAAACTGTGAGTGTGGGACC-3' (SEQ ID NO. 4).

[0092] The probe provided in this example ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid composition for detecting ALDH2 gene mutation and its application and kit and belongs to the technical field of gene detection. The nucleic acid composition comprises one or more of upstream primers shown in the formulas of SEQ ID NO. 1 and 2, a downstream primer shown in the formula of SEQ ID NO. 3 and a capture probe shown in the formula of SEQ ID NO. 4. The end 5' of the downstream primer or the end 5' of the upstream primer is labeled with an affinant for bonding with a catalytic enzyme. The nucleic acid composition can detect G to A mutation of the site rs671 of the ALDH2 gene and has the characteristics of high sensitivity, high specificity, low cost and convenient operation.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a nucleic acid combination for detecting ALDH2 gene mutation, its application and a kit. Background technique [0002] Acetaldehyde dehydrogenase (Acetaldehyde Dehydrogenase, ALDH) is encoded by the ALDH gene and can be divided into ALDH1A1, ALDH1B1 and ALDH2. Among them, ALDH2 has the strongest ability to catalyze acetaldehyde into acetic acid in the human body. The ALDH2 gene is located on chromosome 12 (12q24), consists of 13 exons, and encodes an enzyme protein peptide chain consisting of 500 amino acid residues. Studies have shown that polymorphisms in this gene are common in Asian populations and may affect drinking behavior in the population. ALDH2 is most closely related to Asian populations because of the G→A mutation (G671A mutation site) at the rs671 site of the ALDH2 gene, which can cause the encoded polypeptide chain glutamic acid (Glu) to be changed to lysi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6834C12Q2565/519C12Q2565/607
Inventor廖玮莫亚勤林晓燕张晨光
OwnerGUANGZHOU EZLIFE BIO CO LTD