A kind of immobilization method of lipase
A technology for lipase and rice seeds, applied in biochemical equipment and methods, enzymes, immobilized on/in organic carriers, etc., can solve the problems of high production cost, difficult production scale expansion, limited production capacity, etc. Increase throughput, provide reusability, and reduce production costs
Image
Examples
Embodiment 1
[0023] Example 1: Construction of rice transformation T-DNA vector pCAMB1300-GT1-CalB-CBM
[0024] The lipase amino acid sequence encoding gene (amino acid sequence SEQ ID NO.1), the protein linking peptide encoding gene (amino acid sequence SEQ ID NO.2) and the chitosan binding domain amino acid sequence encoding gene (amino acid sequence SEQ ID NO.3) were sequentially Linked into a lipase fusion gene, artificially synthesized by Shanghai Shenggong Company (Shanghai, China) to contain the nucleotide of the lipase fusion gene and the 35S terminator, its sequence is SEQ ID NO: 4 (wherein 1-957 encodes lipase, 958-1077bp encodes the connecting peptide, 1078-1863bp encodes the chitosan binding domain, and 1864-2047bp is the terminator sequence).
[0025] Using PCR primer GT1-F (5' AAGCTT GAGATTCATCAATATGAGAAAAC, the underline is the HindⅢ site); and GT1-R (5' TCTAGA CTGGGCTAGGGAGCCATCGCAC, the underline is the Xba I site) from rice (Oryza sativajaponica L.) genomic DNA amplif...
Embodiment 2
[0028] Example 2: Obtaining of transgenic rice containing lipase fusion gene
[0029] The method for obtaining the transgenic rice is to use the Agrobacterium infection method, and transform according to the method and medium formula reported by Zhao et al. (Agricultural Sciences in China, 2011, 10(9):1307-1312). The specific steps are: . The mature and plump "Xiushui 134" seeds were dehulled, and callus was induced as transformation materials. Get the Agrobacterium containing the plant transformation vector pCAMB1300-GT1-CalB-CBM obtained in Example 1 and streak culture on the YEP plate containing 50 mg / mL kana resistance, pick a single colony and inoculate it into the YEP liquid medium, and cultivate it at 28°C to OD 660 is 0.5, obtain the Agrobacterium liquid, and prepare the Agrobacterium for transformation. Put the rice callus to be transformed into OD 660 0.5 in the Agrobacterium liquid containing 40mg / mL acetosyringone, shake on a horizontal shaker at 120rpm for 1 ho...
Embodiment 3
[0030] Example 3: Extraction of lipase fusion protein in rice seeds
[0031] The transgenic rice seeds obtained in Example 2 were dehulled, and 5 g of the dehulled seeds were homogenized with 100 ml of Tri-HCL buffer solution of 20 mM pH8.0. After the homogenization, they were shaken and extracted for 2 hours, and the supernatant was taken after standing liquid, the supernatant was filtered through a 300-500 mesh filter, and the obtained filtrate (ie lipase fusion protein solution) was used for lipase immobilization.
PUM
Login to View More Abstract
Description
Claims
Application Information
- IPC
- C12N11/10
- CPC
- C12N9/20; C12N11/10; C12Y301/01003
- Inventors
- 林朝阳; 沈志成



