A kind of immobilization method of lipase

A technology for lipase and rice seeds, applied in biochemical equipment and methods, enzymes, immobilized on/in organic carriers, etc., can solve the problems of high production cost, difficult production scale expansion, limited production capacity, etc. Increase throughput, provide reusability, and reduce production costs

Active Publication Date: 2019-08-13
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, industrial lipase is mainly obtained by microbial fermentation. Microbial fermentation has high requirements for production equipment, transportation and storage, it is difficult to expand the production scale, the production capacity is limited, the production cost is high, and the production process is complicated, and the enzyme purification is also difficult. Reducing the production cost is an important problem to be solved in the industrial production of lipase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of immobilization method of lipase
  • A kind of immobilization method of lipase
  • A kind of immobilization method of lipase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of rice transformation T-DNA vector pCAMB1300-GT1-CalB-CBM

[0024] The lipase amino acid sequence encoding gene (amino acid sequence SEQ ID NO.1), the protein linking peptide encoding gene (amino acid sequence SEQ ID NO.2) and the chitosan binding domain amino acid sequence encoding gene (amino acid sequence SEQ ID NO.3) were sequentially Linked into a lipase fusion gene, artificially synthesized by Shanghai Shenggong Company (Shanghai, China) to contain the nucleotide of the lipase fusion gene and the 35S terminator, its sequence is SEQ ID NO: 4 (wherein 1-957 encodes lipase, 958-1077bp encodes the connecting peptide, 1078-1863bp encodes the chitosan binding domain, and 1864-2047bp is the terminator sequence).

[0025] Using PCR primer GT1-F (5' AAGCTT GAGATTCATCAATATGAGAAAAC, the underline is the HindⅢ site); and GT1-R (5' TCTAGA CTGGGCTAGGGAGCCATCGCAC, the underline is the Xba I site) from rice (Oryza sativajaponica L.) genomic DNA amplif...

Embodiment 2

[0028] Example 2: Obtaining of transgenic rice containing lipase fusion gene

[0029] The method for obtaining the transgenic rice is to use the Agrobacterium infection method, and transform according to the method and medium formula reported by Zhao et al. (Agricultural Sciences in China, 2011, 10(9):1307-1312). The specific steps are: . The mature and plump "Xiushui 134" seeds were dehulled, and callus was induced as transformation materials. Get the Agrobacterium containing the plant transformation vector pCAMB1300-GT1-CalB-CBM obtained in Example 1 and streak culture on the YEP plate containing 50 mg / mL kana resistance, pick a single colony and inoculate it into the YEP liquid medium, and cultivate it at 28°C to OD 660 is 0.5, obtain the Agrobacterium liquid, and prepare the Agrobacterium for transformation. Put the rice callus to be transformed into OD 660 0.5 in the Agrobacterium liquid containing 40mg / mL acetosyringone, shake on a horizontal shaker at 120rpm for 1 ho...

Embodiment 3

[0030] Example 3: Extraction of lipase fusion protein in rice seeds

[0031] The transgenic rice seeds obtained in Example 2 were dehulled, and 5 g of the dehulled seeds were homogenized with 100 ml of Tri-HCL buffer solution of 20 mM pH8.0. After the homogenization, they were shaken and extracted for 2 hours, and the supernatant was taken after standing liquid, the supernatant was filtered through a 300-500 mesh filter, and the obtained filtrate (ie lipase fusion protein solution) was used for lipase immobilization.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lipase immobilization method. The lipase immobilization method comprises the steps that lipase, a protein linking peptide and a chitosan binding domain amino acid sequence are sequentially connected to form a lipase fused protein, chitosan is used as a carrier to fix the lipase fused protein, and fixed lipase is obtained. The fixed lipase is subjected to recycling of fifth times, the conversion rate of cetyl palmitate catalyzed by the fixed lipase fused protein can be still kept 90%. The method can achieve large scale production, the lipase production can be improved, and the production cost can be reduced.

Description

[0001] (1) Technical field [0002] The invention relates to a lipase immobilization method. [0003] (2) Background technology [0004] Lipase, the full name of triacylglycerol hydrolase, is a special class of acyl hydrolase, which can catalyze chemical reactions such as ester bond hydrolysis, ester synthesis, transesterification and stereoisomer resolution at the lipid-water interface. Lipase is widely used in food processing, feed industry, chemical catalysis, oil processing, paper industry, washing industry, leather processing, textile industry and biodiesel production. With the reduction of lipase production cost, the expansion of production scale, and the improvement of lipase application technology, the demand for lipase in industrial production is constantly expanding. [0005] In industrial applications, free lipase is used directly, and it is difficult to separate the lipase after the reaction is completed. On the one hand, it will affect the subsequent continuous pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N11/10
CPCC12N9/20C12N11/10C12Y301/01003
Inventor林朝阳沈志成
OwnerZHEJIANG UNIV