Clone identification and application of 2-oxoglutarate-dependent dioxygenase (2OGD-5) gene participating in tanshinone synthesis

A technology of ketoglutaric acid and dioxygenase, which is applied in the fields of application, genetic engineering, oxidoreductase, etc., and can solve the problems of unknown biosynthesis

Inactive Publication Date: 2017-05-10
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The 2OGD superfamily is the second largest gene family in the plant genome, and its functions mainly involve oxidation and hydroxylation, such as the synthesis of gibberellins and flavonoids, but whether 2OGDs are involved in the biosynthesis of tanshinone is still unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clone identification and application of 2-oxoglutarate-dependent dioxygenase (2OGD-5) gene participating in tanshinone synthesis
  • Clone identification and application of 2-oxoglutarate-dependent dioxygenase (2OGD-5) gene participating in tanshinone synthesis
  • Clone identification and application of 2-oxoglutarate-dependent dioxygenase (2OGD-5) gene participating in tanshinone synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Genome-wide Screening of Danshen 2OGD Family

[0019] 1) Based on the whole genome scan of Danshen 2OG-FeII_Oxy domain (PF03171), 132 members of the 2OGD superfamily of Danshen were screened, and the amino acid sequence length distribution ranged from 120aa to 504aa.

[0020] 2) Using MEGA alignment and constructing a phylogenetic tree, the Salvia miltiorrhiza 2OGD superfamily is divided into two subfamilies, DOXB and DOXC, in which DOXB contains 14 2OGD members, and DOXC contains 116 2OGD members, such as figure 1 shown.

[0021] 3) Collect transcriptome sequencing data of different organ tissues and treatments of Danshen, and use Tophat and Cufflinks software to analyze the differential expression profiles of 2OGD members of Danshen under different organ tissues and MeJA treatment, as shown in figure 2 shown.

[0022] 4) According to the synthesis and accumulation of tanshinone in different parts of Danshen, screen the 2OGD family members with consistent ...

Embodiment 2

[0023] Example 2 Cloning and structural analysis of the gene encoding Salvia miltiorrhiza 2OGD-5

[0024] 1) Align the 2OGD-5 sequences screened in Example 1 to design full-length primers, perform PCR amplification from the cDNA of Danshen root, and obtain a 1089bp nucleotide sequence, such as SEQ ID No.1. According to the translation of the full-length cDNA sequence, the amino acid sequence of Danshen 2OGD-5 was deduced, with a total of 362 amino acid residues, such as SEQ ID No.2.

[0025] 2) Use PyMOL software to predict the protein structure of 2OGD-5, referring to the protein three-dimensional structure model of Arabidopsis AtLDOX (PDBID: 1GP5), such as Figure 4 shown.

Embodiment 3

[0026] Example 3 Salvia miltiorrhiza 2OGD-5 functional identification

[0027] 1) Gateway primer design and fragment amplification. A 186bp RNAi fragment primer was designed for the 2OGD-5 gene (gene position: 304-489bp), and the attB1 sequence: GGGGACAAGTTTGTACAAAAAAGCAGGCT was added to the 5' end, and the attB2 sequence GGGGACCACTTTGTACAAGAAAGCTGGGT was added to the 3' end. When designing RNAi primers, in order to avoid the poor specificity of the designed RNAi region resulting in multiple transgene silencing targets, the RNAi region of each gene was compared with the genome BLAST, and the RNAi region with the best specificity was selected. The primer sequence is as follows:

[0028] F-GGGGACAAGTTTGTACAAAAAAAGCAGGCTCCCTCGGAGACGATGGACG

[0029] R-GGGGACCACTTTGTACAAGAAAGCTGGGTGTCGTCGCTGAAGACGCAC

[0030] 2) Gateway constructs RNAi vector. BP reaction: take 25ng of attB PCR recovery product and 75ng pDONR221 entry vector, add water and mix to 4 μL, then add 1 μL of BPclonase...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an encoding gene sequence of 2-oxoglutarate-dependent dioxygenase (2OGD-5) gene participating in tanshinone synthesis. The provided 2OGD-5 gene has a nucleotide sequence shown as SEQ ID No.1, and protein encoded by the gene has an amino acid sequence shown as SEQ ID No.2. Hairy roots of salvia miltiorrhiza bunge are subjected to genetic transformation by constructing a 2OGD-5-RNAi vector, and compared with the contrast, the content of miltirone, cryptotanshinone and tanshinone is remarkably reduced. The provided 2OGD-5 has the capability of producing tanshinone compounds under catalysis. The compounds have the function of treating cardiovascular disease. The research thought of tanshinone synthesis is innovated, and the encoding gene sequence lays a foundation for artificial synthesis of tanshinone compounds and has huge research and application prospect.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and genetic engineering, and particularly relates to the cloning identification and application of a 2-ketoglutarate-dependent dioxygenase gene involved in tanshinone synthesis. Background technique [0002] The traditional Chinese medicine Salvia miltiorrhiza is the dry root and rhizome of Salvia miltiorrhiza Bunge, a plant of the genus Labiatae. It is one of the most commonly used bulk medicinal materials. Efficacy, it has high application value in clinical treatment of cardiovascular and cerebrovascular diseases. Salvia miltiorrhiza has strong ecological adaptability and is widely distributed in East China, North China, Northwest, Southwest, Central South and other regions. Nowadays, the wild resources of Salvia miltiorrhiza have been greatly reduced, mainly from artificial cultivation products. It is distributed in Hebei, Jiangsu, Anhui, Liaoning, Shaanxi, Shandong, It is widely plante...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/82A01H5/00
CPCC12N9/0067C12N15/8205C12N15/8243C12Y113/12019
Inventor宋经元徐志超
OwnerINST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI