A circRNA PSY1-circ1 involved in lycopene biosynthesis

A tomato and plant technology, applied in the field of nucleic acid, can solve the problem of unclear regulation mechanism of synthetic gene expression, and achieve the effect of being beneficial to genetic regulation

Active Publication Date: 2020-08-25
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The biosynthetic pathway of carotenoid (lycopene) has been extensively studied, but the expression regulation mechanism of its synthetic genes is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A circRNA PSY1-circ1 involved in lycopene biosynthesis
  • A circRNA PSY1-circ1 involved in lycopene biosynthesis
  • A circRNA PSY1-circ1 involved in lycopene biosynthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1. Bioinformatics and molecular biology identification of circRNA PSY1-circ1

[0059] Deep sequencing of circular RNAs in tomato fruit : Trizol (Life technologies) was used to extract the total RNA of wild-type tomato (Solanum lycopersicum) variety (Ailsa Craig, hereinafter referred to as AC) in the green ripening (MG), breaking color (BR) and red ripening (BR+6) fruits , and then digested with DNase I (Fermentas) to remove residual genomic DNA. Afterwards, Ribo-Zero Magnetic Kit-plant leaf (Epicentre) was used to remove ribosomal RNA, and then RNase R (Epicentre) was used to treat at 37°C for 1 hour to digest linear RNA. The circRNA library was built with Illumina's RNA LT Sample Prep Kit v2, the insert length is 120-250bp; HiSeq2500 sequencer (2*100bp) for bidirectional sequencing, using 100bp paired-end reads (Lingneng Biotechnology (Shanghai) Co., Ltd.), valid for each sample The amount of data is more than 4Gbase.

[0060] Extraction and analysis of...

Embodiment 2

[0065] Example 2. Analysis of expression patterns of circRNA PSY1-circ1 and its source genes in tomato fruits at different maturity stages

[0066] Design of special primers for identification of circRNA (real-time PCR method) : Due to the existence of selective circularization, the same gene can produce multiple circRNAs with overlapping regions, so the design of discrete primers (forward primers or reverse primers) to identify circRNAs spans the reverse splicing site (primers span the site The length of the 3' end of the point is 3-6bp) to ensure the specificity of the amplification, see the schematic diagram for details ( Figure 4 ). The rest of the design concept is the same as that of ordinary real-time PCR.

[0067] The primers obtained from this design concept for real-time PCR amplification of circRNA PSY1-circ1 are discrete primers, in which the forward primer is TCAGCTAGTAGATTCCCTCCATTC (SEQ ID NO: 8), and the reverse primer is CCTTTGATTCAGGGGCGATAC (SEQ ID NO: 9...

Embodiment 3

[0071] Example 3. Construction and genetic transformation of circRNA PSY1-circ1 overexpression vector

[0072] Construction of circRNA overexpression vector : Using the genomic DNA of wild-type tomato (AC) as a template, amplify the fragment (fragment A) containing the exon and flanking sequence (upstream 281bp and downstream 681bp) to be circularized (fragment A), and amplify part of the downstream sequence (517bp, fragment B ). Then Fragment A and Fragment B were connected in the opposite direction and constructed into the expression cassette of the pCAMBIA1301 vector ( Figure 6 ). Fragment A and fragment B in the carrier form a secondary structure due to partial sequence complementarity, which is the key to promoting the production of circRNA in large quantities. In addition, the vector retains the splicing sites and some flanking sequences on both sides of the exon to be circularized, ensuring precise splicing.

[0073] genetic transformation : The vector prepared ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of nucleic acids, in particular to a circRNA and its application. More specifically, the present invention provides a sequence of circRNA PSY1-circ1 shown in SEQ ID NO: 1, a pair of primers for amplifying the circRNA PSY1-circ1, and an expression vector comprising the circRNA PSY1-circ1. By means of the circRNA PSY1-circ1 of the present invention, the regulation of plant phytoene synthase 1 gene (PSY1) expression, plant carotenoid content and tomato fruit color development can be achieved.

Description

technical field [0001] The invention relates to the field of nucleic acids, in particular to a circRNA and its application. Background technique [0002] Circular RNAs are a class of single-stranded, covalently closed circular transcripts. In eukaryotes, there is a type of circular RNA derived from Back-Splicing (Lasda and Parker, 2014) of pre-mRNA, called circRNA. [0003] According to reports, circRNAs have been identified as early as more than 20 years ago (Cocquerelle et al., 1993; Nigro et al., 1991; Pasman et al., 1996), but most of them are considered to be the products of abnormal splicing. Neither presence nor potential function was taken into account. [0004] In recent years, with the development of next-generation high-throughput sequencing technology and bioinformatics technology, scientists have discovered that circRNAs are widely present in various eukaryotes (Hansen et al., 2011; Memczak et al., 2013; Salzman et al ., 2013; Salzman et al., 2012; Wang et al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/82A01H5/08A01H6/82
CPCC12N9/1085C12N15/11C12N15/1137C12N15/825C12N2310/532C12Y205/01032
Inventor谭金娟邓志平周忠静
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES