Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular identification method used for Paeonia rockii and Paeonia cathayana

A technology for molecular identification of peony, applied in the field of molecular biology, can solve problems such as identification difficulties, intellectual property protection and identification difficulties of peony varieties, and achieve the effect of avoiding errors

Inactive Publication Date: 2017-09-15
GANSU AGRI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is very difficult to use traditional morphological and histological characteristics to identify, whic...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular identification method used for Paeonia rockii and Paeonia cathayana
  • Molecular identification method used for Paeonia rockii and Paeonia cathayana
  • Molecular identification method used for Paeonia rockii and Paeonia cathayana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0021] Using 4 wild species of Paeonia purpurea from different regions in Gansu, 42 cultivars of Paeonia purpurea and 11 germplasms of peony from the Central Plains in Luoyang as test materials, DNA extraction kits from TIANGEN Company were used to extract DNA from the samples, and the forward primers used were: CCTATATCCGCTACTCCTTC, reverse primer CTCAGTGAATTTCACCACG, PCR amplification conditions were pre-denaturation at 95°C for 5 minutes, followed by 30 seconds at 95°C, annealing at 48°C for 45 seconds, and extension at 72°C for 30 seconds. A total of 35 cycles were performed, and finally extended at 72°C for 7 minutes. After sequencing and comparing, there are 2 fixed difference sites identified at 31bp (base T) and 79bp (base C) for P. peony and Central Plains.

[0022] Such as figure 1 , figure 2 , image 3 as shown, figure 1 , figure 2 Among them, 1-20 represent the cultivars of P. peony, 21-24 represent the cultivars of P. peony in Central Plains, and S is the ma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular identification method used for Paeonia rockii and Paeonia cathayana. The method comprises the following steps: DNA extraction of a sample to be identified; PCR amplification; sequence correction and comparison; and sequence analysis. Experiment researches of the method find that the matK sequence of the Paeonia rockii is different from that of the Paeonia cathayana in the 31bp site and the 79bp site, and the 31bp site and the 79bp site are the most conserved sites, so the two sites can be used as information sites for identifying the Paeonia rockii and the Paeonia cathayana. The invention also provides an application of the matK sequence in the identification of the Paeonia rockii as a DNA bar code .

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular identification method for peony purpura and peony zhongyuan. Background technique [0002] Peony [Peaonia rockii (S.G.Haw et L.A.Lauener) T.Hong et J.J.Li] belongs to Ranunculaceae, Paeonia, peony group, with purple spots at the base of the petals. It is a famous ornamental flower. It is cultivated and planted in Lanzhou City, Gansu Province, In areas such as Linxia and Lintao, there are more than 2,000 varieties of cultivated fine varieties. Because the traditional varieties of purple spot peony are introduced and domesticated from wild species, they are formed by hybridization with Central Plains peony, and the current new cultivated species are reintroduced from Central Plains peony. Therefore, its provenance is complicated, different regions have their own names, and there are often phenomena of the same name and different objects, and the sa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/156
Inventor 唐红丑欢欢
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com