Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for constructing an epo gene knockout zebrafish animal model and primers, plasmids and preparation methods

A technology of gene knockout and animal model, applied in the field of biomedicine, to achieve the effect of deepening the understanding of the effect and high success rate of gene knockout

Active Publication Date: 2021-07-02
THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, research and discussion on how to construct an EPO gene knockout zebrafish animal model based on CRISPR gene knockout technology will help to solve the problem that there is no EPO gene knockout biological model available for scientific research, and provide EPO gene knockout models for EPO research. animal model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing an epo gene knockout zebrafish animal model and primers, plasmids and preparation methods
  • A method for constructing an epo gene knockout zebrafish animal model and primers, plasmids and preparation methods
  • A method for constructing an epo gene knockout zebrafish animal model and primers, plasmids and preparation methods

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0049] The present invention will be further described in detail below in conjunction with specific embodiments, which are explanations of the present invention rather than limitations.

[0050] 1. Establishment of EPO gene knockout zebrafish model

[0051] 1) Establish an Escherichia coli plasmid containing the target sequence of the EPO gene fragment:

[0052] 1-0) The Ensemble database (http: / / www.ensembl.org) obtained the zebrafish EPO gene sequence (ENSDART00000020288.9);

[0053] 1-1) Use Zifit Target Version 4.2 for target sequence selection and primer design for the exon 2 region of the EPO gene, and then synthesize the designed primers;

[0054] Wherein, the target sequence of the selected EPO exon 2 region is shown in SEQ ID NO.1, which is:

[0055] CATCTGTGACCTGCGCGT;

[0056] Among them, the designed and synthesized primers are:

[0057] Forward primer (SEQ ID NO.2) TAGGACGCGCAGGTCACAGATG

[0058] Reverse primer (SEQ ID NO.3) AAACCATCTGTGACCTGCGCGT

[0059] 1-2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing an EPO gene knockout zebrafish animal model, primers, plasmids and a preparation method, and belongs to the technical field of biomedicine. Including steps: 1) establishing the EPO gene knockout zebrafish CRISPR oligomer sequence plasmid; 2) establishing and cultivating the EPO gene knockout zebrafish model based on the CRISPR gene knockout technology; wherein, step 1) specifically includes: 1‑1) Primer design and primer synthesis were carried out for the target sequence in the EPO exon 2 region; 1-2) Synthesis of an E. coli plasmid containing the EPO target sequence. The method for constructing the EPO gene knockout zebrafish animal model provided by the present invention can construct the EPO gene knockout zebrafish animal model, which is convenient for further understanding and research on EPO.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a method for constructing an EPO gene knockout zebrafish animal model based on CRISPR gene knockout technology, primers, plasmids and a plasmid preparation method. Background technique [0002] Erythropoietin (EPO) is a hormone-like substance secreted by the kidney and liver, which plays an important role in inhibiting the apoptosis of primitive erythrocytes and promoting erythropoiesis. Recent studies have shown that EPO plays an important regulatory role in the occurrence and development of heart, kidney, liver diseases, diabetes, hyperlipidemia and other metabolic syndromes, and plays a significant role in oxidative stress and anti-apoptosis. [0003] Due to the low success rate of gene knockout and complicated steps in the preparation of EPO gene knockout based on zinc lipoprotein, Talen and other gene editing technologies, and because the role of EPO is impor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90C12N15/11C12N15/70A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/40A01K2267/03C07K14/505C12N9/22C12N15/70C12N15/902
Inventor 折剑青袁祖贻吴岳邓杨阳娄博文
Owner THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com