RNA polymerase ii33 nucleic acid molecules to control insect pests

A molecular and nucleic acid technology, applied in the field of plant protection effects, can solve problems such as inability to accurately identify effective targets a priori

Inactive Publication Date: 2018-01-02
DOW AGROSCIENCES LLC +1
View PDF127 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Thus, these authors document for the first time the potential of RNAi in the plant kingdom as a viable pest management tool, while at the same time demonstrating that effective targets cannot be accurately identified a priori even from relatively small candidate genomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA polymerase ii33 nucleic acid molecules to control insect pests
  • RNA polymerase ii33 nucleic acid molecules to control insect pests
  • RNA polymerase ii33 nucleic acid molecules to control insect pests

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0365] Example 1: Materials and methods

[0366] Sample Preparation and Bioassays

[0367] use A number of dsRNA molecules (including those corresponding to the following: rpII33-1 reg1 (SEQ ID NO:5), rpII33-2reg1 (SEQ ID NO:6), rpII33-2 v1 (SEQ ID NO:7) and rpII33-2 v2 (SEQ ID NO:8)). Purified dsRNA molecules were prepared in TE buffer, which consisted of a control treatment for all bioassays, which served as a background check for mortality or growth inhibition of WCR (Maize root beetle). use NANODROP TM An 8000 Spectrophotometer (THERMOSCIENTIFIC, Wilmington, DE) measured the concentration of dsRNA molecules in the bioassay buffer.

[0368] Samples were tested for insect activity in a bioassay using neonatal insect larvae fed an artificial insect diet. WCR eggs were obtained from CROP CHARACTERISTICS, INC. (Farmington, MN).

[0369] Bioassays were performed in 128-well plastic trays (C-D INTERNATIONAL, Pitman, NJ) specially designed for insect bioassays. Each well c...

Embodiment 2

[0379] Example 2: Identification of Candidate Target Genes

[0380] Insects from multiple WCR (corn root firefly beetle) developmental stages were selected for pooled transcriptome analysis to provide candidate target gene sequences controlled by RNAi technology for transgenic plant insect protection.

[0381] In one example, total RNA was isolated from approximately 0.9 g of intact first instar WCR larvae (4 to 5 days after hatch; maintained at 16°C) and analyzed using the following phenol / TRI-based The method (MOLECULAR RESEARCH CENTER, Cincinnati, OH) purification:

[0382] Place the larvae in a container containing 10 mL TRI at room temperature Homogenize in a 15 mL homogenizer until a homogeneous suspension is obtained. After 5 minutes of incubation at room temperature, the homogenate was dispensed into 1.5 mL microcentrifuge tubes (1 mL per tube), and the mixture was vigorously shaken for 15 seconds after the addition of 200 μL of chloroform. After allowing the extr...

Embodiment 3

[0392] Example 3: Amplification of target genes to generate dsRNA

[0393] Full-length or partial clones of the sequence of the rpII33 candidate gene were used to generate PCR amplicons for dsRNA synthesis. Primers were designed to amplify the portion of the coding region of each target gene by PCR. See Table 1. The T7 bacteriophage promoter sequence (TTAATACGACTCACTATAGGGAGA; SEQ ID NO:9) was incorporated into the 5' end of the amplified sense or antisense strand, as appropriate. See Table 1. use (Life Technologies, Grand Island, NY) extracted total DNA from WCR, then used the total DNA, using The first-strand synthesis system and the manufacturer's oligo-dT priming instructions (Life Technologies, Grand Island, NY) were used to make first-strand cDNA. The first-strand cDNA is used as a template for a PCR reaction employing reverse-positioned primers to amplify all or part of the native target gene sequence. dsRNA was also amplified from a DNA clone containing the cod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
lengthaaaaaaaaaa
Login to view more

Abstract

This disclosure concerns nucleic acid molecules and methods of use thereof for control of insect pests through RNA interference-mediated inhibition of target coding and transcribed non-coding sequences in insect pests, including coleopteran and / or hemipteran pests. The disclosure also concerns methods for making transgenic plants that express nucleic acid molecules useful for the control of insectpests, and the plant cells and plants obtained thereby.

Description

[0001] priority statement [0002] This application claims the benefit of the filing date of U.S. Provisional Patent Application Serial No. 62 / 133,210, "RNAPOLYMERASE II33 NUCLEIC ACID MOLECULESTO CONTROL INSECT PESTS," filed March 13, 2015, the disclosure of which is hereby incorporated by reference in its entirety into this article. technical field [0003] The present invention relates generally to the genetic control of plant damage caused by insect pests, such as Coleopteran and Hemipteran pests. In particular embodiments, the present invention relates to the identification of target-encoding polynucleotides and non-coding polynucleotides, and the post-transcriptional repression or inhibition of target-encoding and non-coding polynucleotides in insect pest cells using recombinant DNA techniques. expression, thereby providing plant protection effects. Background technique [0004] Western corn rootworm (WCR) (Diabrotica virgifera virgifera LeConte) is one of the most d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/11C12N5/10A01H5/00A01N57/16A01P7/04A01N63/60
CPCC12N15/113A01N57/16C12N15/8286C12N2310/14Y02A40/146A01N63/60C12N15/1137C12N2310/531
Inventor K·E·纳尔瓦S·E·沃登M·弗雷M·朗戈萨米P·甘德拉B·维拉曼尼W·洛A·威尔鑫斯卡斯E·克诺尔E·菲什里维奇
Owner DOW AGROSCIENCES LLC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap